NFH(NEFH) (NM_021076) Human Untagged Clone

CAT#: SC110961

NEFH (untagged)-Human neurofilament, heavy polypeptide (NEFH)

USD 1,957.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NFH(NEFH) (NM_021076) Human Untagged Clone
Symbol NEFH
Synonyms NFH
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC110961 sequence for NM_021076 edited (data generated by NextGen Sequencing)
ATGATGAGCTTCGGCGGCGCGGACGCGCTGCTGGGCGCCCCGTTCGCGCCGCTGCATGGC
GGCGGCAGCCTCCACTACGCGCTAGCCCGAAAGGGTGGCGCAGGCGGGACGCGCTCCGCC
GCTGGCTCCTCCAGCGGCTTCCACTCGTGGACACGGACGTCCGTGAGCTCCGTGTCCGCC
TCGCCCAGCCGCTTCCGTGGCGCAGGCGCCGCCTCAAGCACCGACTCGCTGGACACGCTG
AGCAACGGGCCGGAGGGCTGCATGGTGGCGGTGGCCACCTCACGCAGTGAGAAGGAGCAG
CTGCAGGCGCTGAACGACCGCTTCGCCGGGTACATCGACAAGGTGCGGCAGCTGGAGGCG
CACAACCGCAGCCTGGAGGGCGAGGCTGCGGCGCTGCGGCAGCAGCAGGCGGGCCGCTCC
GCTATGGGCGAGCTGTACGAGCGCGAGGTCCGCGAGATGCGCGGCGCGGTGCTGCGCCTG
GGCGCGGCGCGCGGTCAGCTACGCCTGGAGCAGGAGCACCTGCTCGAGGACATCGCGCAC
GTGCGCCAGCGCCTAGACGACGAGGCCCGGCAGCGAGAGGAGGCCGAGGCGGCGGCCCGC
GCGCTGGCGCGCTTCGCGCAGGAGGCCGAGGCGGCGCGCGTGGACCTGCAGAAGAAGGCG
CAGGCGCTGCAGGAGGAGTGCGGCTACCTGCGGCGCCACCACCAGGAAGAGGTGGGCGAG
CTGCTCGGCCAGATCCAGGGCTCCGGCGCCGCGCAGGCGCAGATGCAGGCCGAGACGCGC
GACGCCCTGAAGTGCGACGTGACGTCGGCGCTGCGCGAGATTCGCGCGCAGCTTGAAGGC
CACGCGGTGCAGAGCACGCTGCAGTCCGAGGAGTGGTTCCGAGTGAGGCTGGACCGACTG
TCGGAGGCAGCCAAGGTGAACACAGACGCTATGCGCTCAGCGCAGGAGGAGATAACTGAG
TACCGGCGTCAGCTGCAGGCCAGGACCACAGAGCTGGAGGCACTGAAAAGCACCAAGGAC
TCACTGGAGAGGCAGCGCTCTGAGCTGGAGGACCGTCATCAGGCCGACATTGCCTCCTAC
CAGGAAGCCATTCAGCAGCTGGACGCTGAGCTGAGGAACACCAAGTGGGAGATGGCCGCC
CAGCTGCGAGAATACCAGGACCTGCTCAATGTCAAGATGGCTCTGGATATAGAGATAGCC
GCTTACAGAAAACTCCTGGAAGGTGAAGAGTGTCGGATTGGCTTTGGCCCAATTCCTTTC
TCGCTTCCAGAAGGACTCCCCAAAATTCCCTCTGTGTCCACTCACATAAAGGTGAAAAGC
GAAGAGAAGATCAAAGTGGTGGAGAAGTCTGAGAAAGAAACTGTGATTGTGGAGGAACAG
ACAGAGGAGACCCAAGTGACTGAAGAAGTGACTGAAGAAGAGGAGAAAGAGGCCAAAGAG
GAGGAGGGCAAGGAGGAAGAAGGGGGTGAAGAAGAGGAGGCAGAAGGGGGAGAAGAAGAA
ACAAAGTCTCCCCCAGCAGAAGAGGCTGCATCCCCAGAGAAGGAAGCCAAGTCACCAGTA
AAGGAAGAGGCAAAGTCACCGGCTGAGGCCAAGTCCCCAGAGAAGGAGGAAGCAAAATCC
CCAGCCGAAGTCAAGTCCCCTGAGAAGGCCAAGTCTCCAGCAAAGGAAGAGGCAAAGTCA
CCGCCTGAGGCCAAGTCCCCAGAGAAGGAGGAAGCAAAATCTCCAGCTGAGGTCAAGTCC
CCCGAGAAGGCCAAGTCCCCAGCAAAGGAAGAGGCAAAGTCACCGGCTGAGGCCAAGTCT
CCAGAGAAGGCCAAGTCCCCAGTGAAGGAAGAAGCAAAGTCACCGGCTGAGGCCAAGTCC
CCAGTGAAGGAAGAAGCAAAATCTCCAGCTGAGGTCAAGTCCCCGGAAAAGGCCAAGTCT
CCAACGAAGGAGGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCC
AAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGGCAGAAGCAAAGTCCCCTGAGAAGGCC
AAGTCCCCAGTGAAGGCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGGAA
GAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGGAAGAAGCAAAGTCCCCTGAG
AAGGCCAAGTCCCCAGTGAAGGAAGAAGCAAAGACCCCCGAGAAGGCCAAGTCCCCAGTG
AAGGAAGAAGCCAAGTCCCCAGAGAAGGCCAAGTCCCCAGAGAAGGCCAAGACTCTTGAT
GTGAAGTCTCCAGAAGCCAAGACTCCAGCGAAGGAGGAAGCAAGGTCCCCTGCAGACAAA
TTCCCTGAAAAGGCCAAAAGCCCTGTCAAGGAGGAGGTCAAGTCCCCAGAGAAGGCGAAA
TCTCCCCTGAAGGAGGATGCCAAGGCCCCTGAGAAGGAGATCCCAAAAAAGGAAGAGGTG
AAGTCCCCAGTGAAGGAGGAGGAGAAGCCCCAGGAGGTGAAAGTCAAAGAGCCCCCAAAG
AAGGCAGAGGAAGAGAAAGCCCCTGCCACACCAAAAACAGAGGAGAAGAAGGACAGCAAG
AAAGAGGAGGCACCCAAGAAGGAGGCTCCAAAGCCCAAGGTGGAGGAGAAGAAGGAACCT
GCTGTCGAAAAGCCCAAAGAATCCAAAGTTGAAGCCAAGAAGGAAGAGGCTGAAGATAAG
AAAAAAGTCCCCACCCCAGAGAAGGAGGCTCCTGCCAAGGTGGAGGTGAAGGAAGACGCT
AAACCCAAAGAAAAGACAGAGGTGGCCAAGAAGGAACCAGATGATGCCAAGGCCAAGGAA
CCCAGCAAACCAGCAGAGAAGAAGGAGGCAGCACCGGAGAAAAAAGACACCAAGGAGGAG
AAGGCCAAGAAGCCTGAGGAGAAACCCAAGACAGAGGCCAAAGCCAAGGAAGATGACAAG
ACCCTCTCAAAAGAGCCTAGCAAGCCTAAGGCAGAAAAGGCTGAAAAATCCTCCAGCACA
GACCAAAAAGACAGCAAGCCTCCAGAGAAGGCCACAGAAGACAAGGCCGCCAAGGGGAAG
TAA

Clone variation with respect to NM_021076.3
2232 t=>c;2784 a=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_021076 unedited
NGGTCATAATTGTATACGACTCACTATAGGCGGCCGCGAATCGGCACGAGCCGTCCCGGC
CTCGCGCACCTGCTCAGGCCATGATGAGCTTCGGCGGCGCGGACGCGCTGCTGGGCGCCC
CGTTCGCGCCGCTGCATGGCGGCGGCAGCCTCCACTACGCGCTAGCCCGAAGGGTGGCGC
AGGCGGGACGCGCTCCGCCGCTGGCTCCTCCAGCGGCTTCCACTCGTGGACACGGACGTC
CGTGAGCTCCGTGTCCGCCTCGCCCAGCCGCTTCCGTGGCGCAGGCGCCGCCTCAAGCAC
CGACTCGCTGGACACGCTGAGCAACGGGCCGGAGGGCTGCATGGTGGCGGTGGCCACCTC
ACGCAGTGAGAAGGAGCAGCTGCAGGCGCTGAACGACCGCTTCGCCGGGTACATCGACAA
GGTGCGGCAGCTGGAGGCGCACAACCGCAGCCTGGAGGGCGAGGCTGCGGCGCTGCGGCA
GCAGCAGGCGGGCCGCTCCGCTATGGGCGAGCTGTACGAGCGCGAGGTCCGCGAGATGCG
CGGCGCGGTGCTGCGCCTGGGCGCGGCGCGCGGTCAGCTACGCCTGGAGCAGGAGCACCT
GCTCGAGGACATCGCGCACGTGCGCCAGCGCCTAGACGACGAGGCCCGGCAGCGAGAGGA
GGCCGAGGCGGCGGCCCGCGCGCTGGCGCGCTTCGCGCANGAGGCCGAGGCGGCGCGCGT
GGACCTGCAGAAGAAGCGCAGGCGCTGCAGGAGGAGTGCGGCTACCTGCGGCGCCACCAC
CAGGAAGAGGTGGGCGAGCTGCTCGGCCAGATCCAGGGCTCCGGCGCCGCGCCAGCGCAG
ATGCANGCCGAGACGCGCGACGCCCTGAAGTGCGACGTGACGTCCGCGCTGCGCGAGATC
C
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021076 unedited
GTACCGCGGCACGCAATCTAGTAGTCGAGNNNNNNTTTTTTTTTTTTTTTTTTTCCATTT
TATAAGCACTTGGTTTTATTGCACAGATACAATTGAAAGTGAACTCCAGTGGAAAGTGCG
CCCTGGCATAATTCATTGGCCAGTGCCCGGCCCCACCTGGACCGCTCTTCCAAAATAAAG
AGCTCTGGGCAAGGGCTTGACCACTCCTTTGGAAAACAGAAGGCATTTGGGAATAGGTTA
AGACATCTCAAGCATAATGTATTTCTAACTGCTCATTCATTATTGCGGTCATCTGTCAGT
TGCACATAGAGGCAATAAATGCACTTATTTGGAAAGGAGGGGGGCAGTTTTTATAGTCAA
GTGTTTACGTGTGGCATTCGGCATGTATCACATTCAGCTACATAAGCTATCATAATTGTC
CATCGCCTGGGGAGGGCATGGGGGCAGGGGCCTGGGAGTGCCCTCTCTTGCTAACATATG
GCTAACAAAAATTCCTGTTTGAAGAAGGAGGCCCCGTCATCTAACCAGTTTTCTTTTTAC
TTAAAAACAGAAAAAGTGAAAATTGTGTTACTCTGATCCTTGACCTCCGGGACTCTTCTG
AGTTTTTTGGCCTGTTCCGGTGTTCCTTTCCCCTGCCTTACTTCCCCTGGGCGGCCTTGT
TTTTTGGGGCCTTCTTTGAAGCTCGCTGTCTTTTTGGCCGGGCCTGAAGAATTTTAAACC
CTTTCTGCCCTAGCTTGCAAGGCTCTTTAAAAAGGCCTTCGGAATTTCTCTTGGCTTAGC
CCTCTGTCTTGGGTTCCTCCCAAAAGCTTTTGGACCCTTCCCCCCCTCGGTGTCTCTTTN
TCCCCGGGCCCGCCCCTTTCTCTCTGCCCGTTTCGCGTGGTCTCTCCGCCCGGTCATATC
TCGTTTTCTTTTTTCCCACCCCCGGTTTCCTTTGACTAAGCGCTTCTCCTATCCTCCACT
TTATGAGACTACTCTTTTGGCGGTCCACTCCTCTCTTCTTCCGCCCGTCCTCCTCGGTCC
CTGCCCGTCTCTCCTCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021076
ORF Size 3063 bp
Insert Size 3740
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021076.2, NP_066554
RefSeq Size 3695
Locus ID 4744
Cytogenetics 22q12.2
Domains filament
Protein Families Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS)
Gene Summary Neurofilaments usually contain three intermediate filament proteins: L, M, and H which are involved in the maintenance of neuronal caliber. NF-H has an important function in mature axons that is not subserved by the two smaller NF proteins. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.