Neurofilament(NEFM) (NM_005382) Human Untagged Clone

CAT#: SC108545

NEFM (untagged)-Human neurofilament, medium polypeptide (NEFM), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Neurofilament(NEFM) (NM_005382) Human Untagged Clone
Symbol NEFM
Synonyms NEF3; NF-M; NFM
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005382, the custom clone sequence may differ by one or more nucleotides


ATGAGCTACACGTTGGACTCGCTGGGCAACCCGTCCGCCTACCGGCGGGTAACCGAGACCCGCTCGAGCT
TCAGCCGCGTCAGCGGCTCCCCGTCCAGTGGCTTCCGCTCGCAGTCGTGGTCCCGCGGCTCGCCCAGCAC
CGTGTCCTCCTCCTATAAGCGCAGCATGCTCGCCCCGCGCCTCGCTTACAGCTCGGCCATGCTCAGCTCC
GCCGAGAGCAGCCTTGACTTCAGCCAGTCCTCGTCCCTGCTCAACGGCGGCTCCGGACCCGGCGGCGACT
ACAAGCTGTCCCGCTCCAACGAGAAGGAGCAGCTGCAGGGGCTGAACGACCGCTTTGCCGGCTACATAGA
GAAGGTGCACTACCTGGAGCAGCAGAATAAGGAGATTGAGGCGGAGATCCAGGCGCTGCGGCAGAAGCAG
GCCTCGCACGCCCAGCTGGGCGACGCGTACGACCAGGAGATCCGCGAGCTGCGCGCCACCCTGGAGATGG
TGAACCACGAGAAGGCTCAGGTGCAGCTGGACTCGGACCACCTGGAGGAAGACATCCACCGGCTCAAGGA
GCGCTTTGAGGAGGAGGCGCGGTTGCGCGACGACACTGAGGCGGCCATCCGCGCGCTGCGCAAAGACATC
GAGGAGGCGTCGCTGGTCAAGGTGGAGCTGGACAAGAAGGTGCAGTCGCTGCAGGATGAGGTGGCCTTCC
TGCGGAGCAACCACGAGGAGGAGGTGGCCGACCTTCTGGCCCAGATCCAGGCATCGCACATCACGGTGGA
GCGCAAAGACTACCTGAAGACAGACATCTCGACGGCGCTGAAGGAAATCCGCTCCCAGCTCGAAAGCCAC
TCAGACCAGAATATGCACCAGGCCGAAGAGTGGTTCAAATGCCGCTACGCCAAGCTCACCGAGGCGGCCG
AGCAGAACAAGGAGGCCATCCGCTCCGCCAAGGAAGAGATCGCCGAGTACCGGCGCCAGCTGCAGTCCAA
GAGCATCGAGCTAGAGTCGGTGCGCGGCACCAAGGAGTCCCTGGAGCGGCAGCTCAGCGACATCGAGGAG
CGCCACAACCACGACCTCAGCAGCTACCAGGACACCATCCAGCAGCTGGAAAATGAGCTTCGGGGCACAA
AGTGGGAAATGGCTCGTCATTTGCGCGAATACCAGGACCTCCTCAACGTCAAGATGGCTCTGGATATAGA
AATCGCTGCGTACAGAAAACTCCTGGAGGGTGAAGAGACTAGATTTAGCACATTTGCAGGAAGCATCACT
GGGCCACTGTATACACACCGACCCCCAATCACAATATCCAGTAAGATTCAGAAACCCAAGGTGGAAGCTC
CCAAGCTTAAGGTCCAACACAAATTTGTCGAGGAGATCATAGAGGAAACCAAAGTGGAGGATGAGAAGTC
AGAAATGGAAGAGGCCCTGACAGCCATTACAGAGGAATTGGCCGTTTCCATGAAGGAAGAGAAGAAAGAA
GCAGCAGAAGAAAAGGAAGAGGAACCCGAAGCTGAAGAAGAAGAAGTAGCTGCCAAAAAGTCTCCAGTGA
AAGCAACTGCACCTGAAGTTAAAGAAGAGGAAGGGGAAAAGGAGGAAGAAGAAGGCCAGGAAGAAGAGGA
GGAAGAAGATGAGGGAGCTAAGTCAGACCAAGCCGAAGAGGGAGGATCCGAGAAGGAAGGCTCTAGTGAA
AAAGAGGAAGGTGAGCAGGAAGAAGGAGAAACAGAAGCTGAAGCTGAAGGAGAGGAAGCCGAAGCTAAAG
AGGAAAAGAAAGTGGAGGAAAAGAGTGAGGAAGTGGCTACCAAGGAGGAGCTGGTGGCAGATGCCAAGGT
GGAAAAGCCAGAAAAAGCCAAGTCTCCTGTGCCAAAATCACCAGTGGAAGAGAAAGGCAAGTCTCCTGTG
CCCAAGTCACCAGTGGAAGAGAAAGGCAAGTCTCCTGTGCCCAAGTCACCAGTGGAAGAGAAAGGCAAGT
CTCCTGTGCCGAAATCACCAGTGGAAGAGAAAGGCAAGTCTCCTGTGTCAAAATCACCAGTGGAAGAGAA
AGCCAAATCTCCTGTGCCAAAATCACCAGTGGAAGAGGCAAAGTCAAAAGCAGAAGTGGGGAAAGGTGAA
CAGAAAGAGGAAGAAGAAAAGGAAGTCAAGGAAGCTCCCAAGGAAGAGAAGGTAGAGAAAAAGGAAGAGA
AACCAAAGGATGTGCCAGAGAAGAAGAAAGCTGAGTCCCCTGTAAAGGAGGAAGCTGTGGCAGAGGTGGT
CACCATCACCAAATCGGTAAAGGTGCACTTGGAGAAAGAGACCAAAGAAGAGGGGAAGCCACTGCAGCAG
GAGAAAGAGAAGGAGAAAGCGGGAGGAGAGGGAGGAAGTGAGGAGGAAGGGAGTGATAAAGGTGCCAAGG
GATCCAGGAAGGAAGACATAGCTGTCAATGGGGAGGTAGAAGGAAAAGAGGAGGTAGAGCAGGAGACCAA
GGAAAAAGGCAGTGGGAGGGAAGAGGAGAAAGGCGTTGTCACCAATGGCCTAGACTTGAGCCCAGCAGAT
GAAAAGAAGGGGGGTGATAAAAGTGAGGAGAAAGTGGTGGTGACCAAAACGGTAGAAAAAATCACCAGTG
AGGGGGGAGATGGTGCTACCAAATACATCACTAAATCTGTAACCGTCACTCAAAAGGTTGAAGAGCATGA
AGAGACCTTTGAGGAGAAACTAGTGTCTACTAAAAAGGTAGAAAAAGTCACTTCACACGCCATAGTAAAG
GAAGTCACCCAGAGTGACTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_005382 unedited
TTGGATTTTGTATCCGACTTATATGGGCGGCCCGCGATTCGGCACGAGGCGCCCCAAGGC
CTCCAAGTATGAGCTACACGTTGGACTCGCTGGGCAACCCGTCCGCCTACCGGCGGGTAA
CCGAGACCCGCTCGAGCTTCAGCCGCGTCAGCGGCTCCCCGTCCAGTGGCTTCCGCTCGC
AGTCGTGGTCCCGCGGCTCGCCCAGCACCGTGTCCTCCTCCTATAAGCGCAGCATGCTCG
CCCCGCGCCTCGCTTACAGCTCGGCCATGCTCAGCTCCGCCGAGAGCAGCCTTGACTTCA
GCCAGTCCTCGTCCCTGCTCAACGGCGGCTCCGGACCCGGCGGCGACTACAAGCTGTCCC
GCTCCAACGAGAAGGAGCAGCTGCAGGGGCTGAACGACCGCTTTGCCGGCTACATAGAGA
AGGTGCACTACCTGGAGCAGCAGAATAAGGAGATTGAGGCGGAGATCCAGGCGCTGCGGC
AGAAGCAGGCCTCGCACGCCCAGCTGGGCGACGCGTACGACCAGGAGATCCGCGAGCTGC
GCGCCACCCTGGAGATGGTGAACCACGAGAAGGCTCAGGTGCAGCTGGACTCGGACCACC
TGGAGGAAGACATCCACCGGCTCAAGGAGCGCTTTGGGNAGGGAGGCCNCCGGTTGCGCC
GACGACACTGGATGCGGCCATTCCGCGCGCTGCGCATAGACATCGAGGAGGCCGTCGCTG
GTCAAGGTGGNAGCTGGACAATGATGGTGCAGTCGCTGCAGNATGAAGGTGCCCTTCCTG
CGGAGCATCCCGAGGGAGGAGGGTGCCCGGACTTCTGGCCCAGATCCAGGCATCGNACAT
CACGGTGGGAGCGCAAAGACTAACCTGAGACAGACTTCTCGGCGGCGCCGAAGGAAATCC
GCTCCCAGCTCGAAAGCCATTAAACCAAATTTGCCCAGGCCGATAATGGTTCAAATGCCG
GTCCCCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005382 unedited
CTTTGGCCCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTATGTTTCCA
ATATGACCTTTATTGAGCAAGTACTGCTGTGACGTTTAACATCGATCAACATAAGATTGC
AAACTGTGCATGTCAACGAGGTTCTCCCATGAACAAAAGTCCATTTTAAATGCACCAGTG
AGGTAAACATAATTATTCATATATAGCTTTCTTAAGGCTGAGTTCTGTGTTTCATTTATT
GTTTTTGGCTCAGTTGGTACTTTGCATAATACATCTCAAGACATCCCCCCTTAAGTGACC
CCCTTCCAACAGCTTAGGAAATCGGCAAATTTCCCAGGTACATACAATATCATGCATTTG
AATCCCCCAAAGACTGAGGAGGGAGCACCCTGAGCTTGCATGCAGTCCCCTCATATTGCA
CAAAGTAAAATACAATGTCTGGAGCCCCCATGGGAGAACCCGTTCTGTTTTGAAGCTGCC
AATCACATGCATTTTGAAATTGTCATATGGCTTAACCTTTTGCAATGGACTCAAATCTTA
GTCACTCTGGGTGACTTCCTTTACTATGGCGTGTGAAGTGACTTTTTCTACCTTTTTAGT
AGACACTAGTTTCTCCTCAAAGGTCTCTTCATGCTCTTCAACCTTTTGAGTGACGGTTAC
AGATTTAGTGATGTATTTGGTAGCACCATCTCCCCCCTCACTGGTGATTTTTTCTACCGT
TTTGGTCACCACCACTTTCTCCTCACTTTTATCACCCCCCTTCTTTTCATCTGCTGGGCT
CAAGTCTAGGCCATTGGTGACAACGCCTTTTCTCCTCTTTCCTCCCACTGCCTTTTTTCC
TTGGGNCTCCTGCTNCTACCTNNCTCTTTTCCTTCTACCTTCCCATTGACGCTATGNCTT
CCTTCCTGGATCCTTTGGACCTTTAATACTACCTTCCTCCTAATTACCTCCTTTCTTCCC
GCTTTTTCCTTTTCTTTTTCCTGGTGGAGGGGCTCCCCCTTTCTCTTG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005382
ORF Size 2751 bp
Insert Size 3330
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005382.1, NP_005373
RefSeq Size 3238
Locus ID 4741
Cytogenetics 8p21.2
Domains filament, filament_head
Protein Pathways Amyotrophic lateral sclerosis (ALS)
Gene Summary Neurofilaments usually contain three intermediate filament proteins: L, M, and H which are involved in the maintenance of neuronal caliber. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.