MRP5(ABCC5) (AK090667) Human Untagged Clone

CAT#: SC101361

(untagged)-Human cDNA FLJ33348 fis, clone BRACE2003892

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MRP5(ABCC5) (AK090667) Human Untagged Clone
Symbol ABCC5
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for AK090667, the custom clone sequence may differ by one or more nucleotides


CATTCCTCTGGGTAGCACCATATGCAGGCTTTGCGAATAAAGTGATCATGGGCTTTCTTGATTCCATTTG
GCCAATGCAAGAACTTCATTGGCTCCCCTCTAAAAAAAATTCCATGGATTGCTGGGATTTTTATTTTTTA
TTTTTTGAAAAAAATGGTACCTATCCGTATTCAGCTTGGTGGCTTCACAGTCCCTCCCCTGAACATCCGT
ATATTCCTTATTCTCTCATTTATGGTGCAGAACACTGGGGTACTAACCTCTAGGAAACTGTTCTAGCTGC
CAGGGAAAGCTAAGAGCCCTCCTTTAACAGGAAAGCAGCAGCATGCTTTTTCTTCTCTCTGCCGTTTCAG
GGAAGAGCACCTTAAGGCCAGTGTTATTTCATGGGATTCTGTCCTAGAGCTGAGAAAGTAATGGACTCAT
CCATAATCTCTTTTATAGATTTGAAAGTGTAAACAATACACACTTCCTTTTTTGGAACTCCAATTCTAAT
ATGTTTCTTTTTCATTGGAAATTGAAAAACCAGGCTGGTTTTGAGATTAGTACTAGCAGTGAGTAAACCT
CCTGTCTGTGGACTTAAATCCTTTTGAGGAACATTTCGTTTTAGATTTTTACAAGTTTTCTAATCTGGCA
CGACTTTCAAACTAGCTTAATCTGTTCTTACAGAAACCTGTGTAAGGACAGACTGCCCACATACGGGCTC
CCCAAACAAAACGGCATTTTTATTTCTTGTCCCTGCTCGGGTTTCACCGAACCTTGGTAGCCATAATCAG
AACAAATGAAACACAGTCAAGTTGTTGTGTTCTGTTTGTTTTTACCTGCCAGCCAGCTGATGCTGACATT
TATACACCAAGATGATCCAAGGTTTTGGTGACGCCGGTGGGGACTGCCGCTATATGTGCAGGGTGCCCGG
GGGTCATAGTAATGTTAATGGAGTACCAGAATCTCTAACAGTGTGGTCCTGTGTAGCCACATTGCTACAC
TTACAGAGATGCTTTGGGGCCTTTTTGGATTAAGACAGTTCTAAAAGACCAGGCCTCACCTATGATCTGT
GTATAAAGAATTAGCATCGCACTGTAGATCTGCAAGAGAAGGCCGCCTCCTGCAGTGCTCTCTCTTGGTG
AATGCTAACTCTGCTCGAGGGCCTTTTGGGGAAAGGACAGTGCAAAACCCTTAGAGAGGTAAGTTTCCCA
CCCTTCCAACCTCTCTCCACCTGCAGCTTGCTTGGTGCTGTCAGGATCTGGATTTGGGGGGAGTCTCTCT
GTAGTGGAACCAGTGACAGAAGCTGTTCTTTAGAATTTTCAGGATGGCTGTATTCTGCGGTCAGAATGAG
AGAGTCAAGCTGGGCAGAATCTCTCGCCAAGAGTTCAGGTAAGGTAATGTTTATTCACTGGGAATGCTTT
CCACAGCCAGACAGCTATGCTAACAGTCTCAAGTTTTCTTCCAGTTTGTTTAGATTTAAATGATACATTT
GTAACTTTTTAAAAACTAAATTTTGGTTGGATTTTTCATGAAAACCTCTTTTTTCTTTATCCCCTAAAAA
ATGGTTTGAAATGTCATTGTTATTTAAAAACCCGATGTGTTGGAACTTCTTTAATCTGCTGTTTCCTCTT
TTTCCCCCCCTTTGAAAGTTTCGCATAGTGTAAACATTCACTATGTCTTTTACCTTCCCTGCTCCTCCCA
TCTGGGAGGCGCTGATGCTATTACCCAGTGCTGAAAAATGGCACTCTAAAGGTATGGGAAGGAAGGAGCC
CAAGGCAACCACCTGCTGTCCTTTCAGCCTTCCTTTGGAGACTGCTCCATCAGTGCCGAGGTGTGTGGGA
ACAGGCTTCACTGCACCGCCATCTTACTGAGTTGCTTCACGTGAGGAAAAGGGGGCTTTGGCCCTGTGAC
TCAGTTCCACATTTTGGATTGCATACTGGAAAAGAAGCCAATCTTCTTGCTAGTAAACCAGCAACCCGGC
TGTATACAGTGGTGACCCAAGCAATGGATATAAACCTAAAAATCTGAGGGAGGGGAGAGGTGGAATACAG
TAGTTCTTGGAATCTGAAGTCTCCTATTTGATCAGGTTATTTCCTGGGACTTGGCAAAAATCTGATTGGT
GGGGATCTCCTAGGACCTAGTGGACATCTGGTATTAATTTAATCTCAGGAAAAACAAGAAATTAACCCAG
AGAGAGTCTGGGTTCTGGAATTCAGCGTAGCTACCTCCAGACCGTGGTGTCTGGCCTCCATTTTTGTCTG
TCATTCAGCTCTGACTTACAGCTGCAATCACCTTTGCTATAAGGCACCTGGGTAGAAGGGTGGATGGGCT
TCACATCAATTTTTTTCTTCCTTTAGGGTGGGGGATTGGTTTGGCTTTCTTTTGTTGTGGCTTTTTGTTT
TATTTTTGTCAAGATTGATTTTTAGATGCAAGGACTTGAAAAGACCCAGAAGGATGCCACCAGTTTTTCC
TTGAGGCCTAGGATTTTTTATTCTGTCCCGAGCAGAGGTAATTCCTCACAACTTAGTGCACCAGTAGCAC
CAGCCGTTTTGAGCAGAGTACCTCTTTGGGGAGCTTTTCGTTTTGTTTTGTTTTTAATTCTCTTTCCTTA
GCAGCAAGGTCTTTTTTCCTAGAGAATCTACTCCGTTGCAGAATCATTGCAACCTCAGGAGCCCTCACTG
ATTGAGTGCTGTCAGCCTGATATACTACTTTGGACTCTGGAAACAGATATGGGTTCTATTCTCTATTTCT
ACTGTGTGTCGTTAAACAACCGTCGGAGACCAGATGACCTGTTAGATGGCTAGTCCTGTATAACTCGACT
CTGTATGTTTCAATGTATGTTACTGCAATGCTTCACCTGCTGTACAGTGTTTGTGAGATGCTCTTTGAAG
ATGGTACTTTTATATTTTTTCATTTTCAATAAAAGTACATTCCTTCCC


5' Read Nucleotide Sequence
>OriGene 5' read for AK090667 unedited
NGGTCAAATATTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGATGAAACA
CAGTCAAGTTGTTGTGTTCTGTTTGTTTTTACCTGCCAGCCAGCTGATGCTGACATTTAT
ACACCAAGATGATCCAAGGTTTTGGTGACGCCGGTGGGGACTGCCGCTATATGTGCAGGG
TGCCCGGGGGTCATAGTAATGTTAATGGAGTACCAGAATCTCTAACAGTGTGGTCCTGTG
TAGCCACATTGCTACACTTACAGAGATGCTTTGGGGCCTTTTTGGATTAAGACAGTTCTA
AAAGACCAGGCCTCACCTATGATCTGTGTATAAAGAATTAGCATCGCACTGTAGATCTGC
AAGAGAAGGCCGCCTCCTGCAGTGCTCTCTCTTGGTGAATGCTAACTCTGCTCGAGGGCC
TTTTGGGGAAAGGACAGTGTAAAACCCTTAGAGAGGTAAGTTTCCCACCCTTCCAACCTC
TCTCCACCTGCAGCTTGCTTGGTGCTGTCAGGATCTGGATTTGGGGGGGAGTCTCTCTGT
AGTGGAACCAGTGAAGAAAGCTGTTCTTTAGAATTTTCAGGATGGCTGTATNCTGCGGTC
AGAATGAGAGAGTCAAGCTGGGCAGAATCTCTGCCAAGAGTTCAAGTAAGGTAATGTTTA
TTCACTGNGAATGCTTTCCACAGCCAGACAGCTATGCTAACAGTCTCAAGTTTTCTTCNC
AGTTTGTTTAGATTTAAATGATACATTTGTAACTTTTTAAAATAAATTTTGNTTTGGATT
TTTCATGAAAACCTCTTTTTTCTTTATCCCTANAAAATGGTTNGAATGTCATTGNTATTT
AAAAACCGATGTGTTGGAAACTCTTAATCTGCTGTTNCCTCTTTTCCCCCTTTTGAAAGT
TCGCATATGGTAACATCACTATGNCTTTTACTTCCTGCTCTCATATNNGNAA
3' Read Nucleotide Sequence
>OriGene 3' read for AK090667 unedited
NGGGGGAATACTGTGNNACGCGGNCCGCTTNCNANGATCGAGTTTTTTTTTTTTTTTTTT
GGGGAAGGAATGTACTTTTATTGAAAATGAAAAAAATAAAAGTACCATCTTCAAAGAGCA
TCTCACAAACACTGTACAGCAGGTGAAGCATTGCAGTAACATACATTTGAAACATACAGA
GGTCGAGTTATACAGGACTAGCCATCTAACAGGTCATCTGGTCTCCGACGGTTGTTTAAC
GACACACAGTAGAAATAGAGAATAGAACCCATATCTGTTTCCAGAGTCCAAAGTAGTATA
TCAGGCTGACAGCACTCAATCAGTGAGGGCTCCTGAGGTTGCAATGATTCTGCAACGGAG
TAGATTCTCTAGGAAAAAAGACCTTGCTGCTAAGGAAAGAGAATTAAAAACAAAACAAAA
CGAAAAGCTCCCCAAAGAGGTACTCTGCTCAAAATGGCTGGTGCTACTGGTGCACTAAGT
TGTGAGGAATTACCTCTGCTCGGGACAGAATAAAAAATCCTAGGCCTCAAGGAAAAACTG
GTGGCATCCTTCTGGGTCTTTTCAAGTCCTTGCATCTAAAAATCAATCTTGACAAAAATA
AAACAAAAAACCACAACAAAAGAAAGCCAAACCAATCCCCCACCCTAAAGGAAGAAAAAA
ATTGATGTGAAGCCCATCCACCCTTCTACCCANGTGCCTTATAGCAAAGGTGACTGCAGC
TGTTAGTCAGAGCTGAATGACAGACAAAAATGGAGGCCAGACACCACGGTCTGGAGGTAG
CTACGCCTGATTCCAGAACCCAGACTCTCTCTGGGGGTAATTTTCTGGTTTTCCCTGAGA
TTAATTAATTACAGATGTCCACTAAGTCCTAGGAGATCCCACCCATCAGATTTTTGCCCA
GTCCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AK090667
ORF Size 2918 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2918
RefSeq ORF 2918
Locus ID 10057
Cytogenetics 3q27.1
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.