Nicastrin(NCSTN) (NM_015331) Human Untagged Clone

CAT#: SC100655

NCSTN (untagged)-Human nicastrin (NCSTN)

USD 1,360.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nicastrin(NCSTN) (NM_015331) Human Untagged Clone
Symbol NCSTN
Synonyms ATAG1874
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC100655 sequence for NM_015331 edited (data generated by NextGen Sequencing)
ATGGCTACGGCAGGGGGTGGCTCTGGGGCTGACCCGGGAAGTCGGGGTCTCCTTCGCCTT
CTGTCTTTCTGCGTCCTACTAGCAGGTTTGTGCAGGGGAAACTCAGTGGAGAGGAAGATA
TATATCCCCTTAAATAAAACAGCTCCCTGTGTTCGCCTGCTCAACGCCACTCATCAGATT
GGCTGCCAGTCTTCAATTAGTGGAGACACAGGGGTTATCCACGTAGTAGAGAAAGAGGAG
GACCTACAGTGGGTATTGACTGATGGCCCCAACCCCCCTTACATGGTTCTGCTGGAGAGC
AAGCATTTTACCAGGGATTTAATGGAGAAGCTGAAAGGGAGAACCAGCCGAATTGCTGGT
CTTGCAGTGTCCTTGACCAAGCCCAGTCCTGCCTCAGGCTTCTCTCCTAGTGTACAGTGC
CCAAATGATGGGTTTGGTGTTTACTCCAATTCCTATGGGCCAGAGTTTGCTCACTGCAGA
GAAATACAGTGGAATTCGCTGGGCAATGGTTTGGCTTATGAAGACTTTAGTTTCCCCATC
TTTCTTCTTGAAGATGAAAATGAAACCAAAGTCATCAAGCAGTGCTATCAAGATCACAAC
CTGAGTCAGAATGGCTCAGCACCAACCTTCCCACTATGTGCCATGCAGCTCTTTTCACAC
ATGCATGCTGTCATCAGCACTGCCACCTGCATGCGGCGCAGCTCCATCCAAAGCACCTTC
AGCATCAACCCAGAAATCGTCTGTGACCCCCTGTCTGATTACAATGTGTGGAGCATGCTA
AAGCCTATAAATACAACTGGGACATTAAAGCCTGACGACAGGGTTGTGGTTGCTGCCACC
CGGCTGGATAGTCGTTCCTTTTTCTGGAATGTGGCCCCAGGGGCTGAAAGCGCAGTGGCT
TCCTTTGTCACCCAGCTGGCTGCTGCTGAAGCTTTGCAAAAGGCACCTGATGTGACCACC
CTGCCCCGCAATGTCATGTTTGTCTTCTTTCAAGGGGAAACTTTTGACTACATTGGCAGC
TCGAGGATGGTCTACGATATGGAGAAGGGCAAGTTTCCCGTGCAGTTAGAGAATGTTGAC
TCATTTGTGGAGCTGGGACAGGTGGCCTTAAGAACTTCATTAGAGCTTTGGATGCACACA
GATCCTGTTTCTCAGAAAAATGAGTCTGTACGGAACCAGGTGGAGGATCTCCTGGCCACA
TTGGAGAAGAGTGGTGCTGGTGTCCCTGCTGTCATCCTCAGGAGGCCAAATCAGTCCCAG
CCTCTCCCACCATCTTCCCTGCAGCGATTTCTTCGAGCTCGAAACATCTCTGGCGTTGTT
CTGGCTGACCACTCTGGTGCCTTCCATAACAAATATTACCAGAGTATTTACGACACTGCT
GAGAACATTAATGTGAGCTATCCCGAATGGCTGAGCCCTGAAGAGGACCTGAACTTTGTA
ACAGACACTGCCAAGGCCCTGGCAGATGTGGCCACGGTGCTGGGACGTGCTCTGTATGAG
CTTGCAGGAGGAACCAACTTCAGCGACACAGTTCAGGCTGATCCCCAAACGGTTACCCGC
CTGCTCTATGGGTTCCTGATTAAAGCCAACAACTCATGGTTCCAGTCTATCCTCAGGCAG
GACCTAAGGTCCTACTTGGGTGACGGGCCTCTTCAACATTACATCGCTGTCTCCAGCCCC
ACCAACACCACTTATGTTGTACAGTATGCCTTGGCAAATTTGACTGGCACAGTGGTCAAC
CTCACCCGAGAGCAGTGCCAGGATCCAAGTAAAGTCCCAAGTGAAAACAAGGATCTGTAT
GAGTACTCATGGGTCCAGGGCCCTTTGCATTCTAATGAGACGGACCGACTCCCCCGGTGT
GTGCGTTCTACTGCACGATTAGCCAGGGCCTTGTCTCCTGCCTTTGAACTGAGTCAGTGG
AGCTCTACTGAATACTCTACATGGACTGAGAGCCGCTGGAAAGATATCCGTGCCCGGATA
TTTCTCATCGCCAGCAAAGAGCTTGAGTTGATCACCCTGACAGTGGGCTTCGGCATCCTC
ATCTTCTCCCTCATCGTCACCTACTGCATCAATGCCAAAGCTGATGTCCTTTTCATTGCT
CCCCGGGAGCCAGGAGCTGTGTCATACTGA

Clone variation with respect to NM_015331.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_015331 unedited
GATTTTGTAATACGACTTACTATAGGGCGGCCGCGAATTCGGCACCGCGCTAACAGACAG
AGCCGAACGGGGGCTTCCGCTCAGCAGAGAGGCAAGATGGCTACGGCAGGGGGTGGCTCT
GGGGCTGACCCGGGAAGTCGGGGTCTCCTTCGCCTTCTGTCTTTCTGCGTCCTACTAGCA
GGTTTGTGCAGGGGAAACTCAGTGGAGAGGAAGATATATATCCCCTTAAATAAAACAGCT
CCCTGTGTTCGCCTGCTCAACGCCACTCATCAGATTGGCTGCCAGTCTTCAATTAGTGGA
GACACAGGGGTTATCCACGTAGTAGAGAAAGAGGAGGACCTACAGTGGGTATTGACTGAT
GGCCCCAACCCCCCTTACATGGTTCTGCTGGAGAGCAAGCATTTTACCAGGGATTTAATG
GAGAAGCTGAAAGGGAGAACCAGCCGAATTGCTGGTCTTGCAGTGTCCTTGACCAAGCCC
AGTCCTGCCTCAGGCTTCTCTCCTAGTGTACAGTGCCCAAATGATGGGTTTGGTGTTTAC
TCCAATTCCTATGGGCCAGAGTTTGCTCACTGCAGAGAAATACAGTGGAATTCGCTGGGC
AATGGTTTGGCTTATGAAGACTTTAGTTTCCCCATCTTTCTTCTTGAAGATGAAAATGAA
ACCAAAGTCATCAAGCAGTGCTATCAAGATCACAACCTGAGTCAGAATGGCTCAGCACCA
ACCTTCCCACTATGTGCCATGCAGCTCTTTTCACACATGCATGCTGTCATCAGCACTGCC
ACCTGCATGCNGCGCAGCTCCATCCAAAGCACCTTCAGCATCAACCCAGAAATCGTCTGT
GACCCCCTGTCTGATTACCATGTGTGGAGCATGCTAAAGCCTATNAATACCACTGGGACA
TTAAAGCCTGACGACAGGGTTGTGGNTTGCTGCACCNNGCTGATAAGTCGTCCTTTTTCT
GGATGTGGCCCCAGGGGCTGAAGCGCATGGCTTCTTTGTACCCACTGGCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_015331 unedited
GGGGGGTGAAAGTCAATGCTTTTTGATGNCAACTCTTAGTATATATTTACAAAAGCAATA
AGGAAAAAGACAAAAACAAAAATAGATATTACAGCTTAATAAAAAGTACAACTGAGCACT
GTGGGCTGGAGGTGGGATACCCACCCGCAGCACGCCCACCCTAATGTGCCATCTGAGGGC
CTGCCACAAAGGACAGTGGGCAACGAGACAGTAGGCTCAGCCCATATATTCCTCTGTCCT
CAGGGGCTCAATGTACCTTGACCCTGACATTAAACCTTTTATGTACCTTCCCAGTCACGA
AGGTGGCTTGGGTACATTGGATGCGGGCGCGCGCGATCATTATAGAGGTACAGGGCAGGA
AGGAAAAAGTAGAAGGGTCCTGAAGGGCCAATTATGGTGGGTAACTAGGGAGTTAAACAG
GAGCAAGAAGCTTCTATTTGTAATCCCGCCCTCTGGCATGACGCCGAGAAGGAAGAGGAA
ATGGGGAAGGGGTGATGGGAAAGGGGAGCGGATTGAAGTATAATCGGTGACTTTCTCTAC
ACCGATTTTCGGAATTTGCCATATTTTTTTTCCCCCGCTATTTTTTCCGCCCCCCTCCAT
CCCCCGAAATTAATGTTATGGGTTTTCACTTTACGGCGCCCACCTCTCCATTCATCCCCC
CTGATTGTTTCTCCCCATGAGCCCCCCTTTTGTTTGGCGCCCAATTGGACCAGCGGTATT
AGTTCCCACTGATTTGTATTTGTGCATAAAACGAGAGGATTGCGCCGTTTTTATGTTGTC
CCGACTGTTGGGTCCTGCCTGACTCTAATCGGCTGTAATGGGCCGTATAGAATTACGTTT
AGGCCCGGTCGCCTGTTTTTTCTCCCGTTTGTGTCGCCCCCCCCCCCCCGTTTTTTGTTT
TATTTN
Tag Tag Free
ACCN NM_015331
ORF Size 2130 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_015331.2, NP_056146
RefSeq Size 2944
Locus ID 23385
Cytogenetics 1q23.2
Protein Families Transmembrane, Druggable Genome
Protein Pathways Notch signaling pathway, Alzheimer's disease
Gene Summary Essential subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral membrane proteins such as Notch receptors and APP (beta-amyloid precursor protein). It probably represents a stabilizing cofactor required for the assembly of the gamma-secretase complex. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations