Nrg1 (NM_001271123) Rat Untagged Clone

CAT#: RN216119

Nrg1 (untagged) - Rat neuregulin 1 (Nrg1), transcript variant 6

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Nrg1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216119 representing NM_001271123
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGAGCGCAAAGAAGGCAGAGGCAAGGGGAAGGGCAAGAAGAAGGACCGGGGATCCCGCGGGAAGC
  CCGGGCCCGCCGAGGGCGACCCGAGCCCAGCACTGCCTCCCAGATTGAAAGAAATGAAGAGCCAGGAGTC
  AGCTGCAGGCTCCAAGCTAGTGCTCCGGTGCGAAACCAGCTCCGAGTACTCCTCACTCAGATTCAAATGG
  TTCAAGAATGGGAACGAGCTGAACCGCAAAAATAAACCAGAAAACATCAAGATACAGAAGAAGCCAGGGA
  AGTCAGAGCTTCGAATTAACAAAGCATCCCTGGCTGACTCTGGAGAGTATATGTGCAAAGTGATCAGCAA
  GTTAGGAAATGACAGTGCCTCTGCCAACATCACCATTGTTGAGTCAAACGAGTTCATCACTGGCATGCCA
  GCCTCGACTGAGACAGCCTATGTGTCCTCAGAGTCTCCCATTAGAATCTCAGTTTCAACAGAAGGCGCAA
  ACACTTCTTCATCCACATCGACATCCACGACTGGGACCAGCCATCTCATAAAGTGCGCGGAGAAGGAGAA
  AACTTTCTGTGTGAATGGGGGCGAGTGCTTCACGGTGAAGGACCTGTCAAACCCGTCAAGATACTTGTGC
  AAGTGCCCAAATGAGTTTACTGGTGATCGTTGCCAAAACTACGTAATGGCCAGCTTCTACAGTACGTCCA
  CTCCCTTTCTGTCTCTGCCTGAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271123
• Insert Size: 726 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271123.1, NP_001258052.1
• RefSeq Size: 1412 bp
• RefSeq ORF: 726 bp
• Locus ID: 112400
• UniProt ID: P43322
• Cytogenetics: 16q12.3
• Gene Summary: ligand for Erbb3 and Erbb4 receptors; gene produces many different alternative splicing isoforms; involved in neural and organ development [RGD, Feb 2006]
  Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence and the 3' UTR and coding sequence compared to variant 1. The resulting isoform (6) has shorter and distinct N- and C-termini compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.