Zfyve27 (NM_199104) Rat Untagged Clone

CAT#: RN214883

Zfyve27 (untagged ORF) - Rat zinc finger, FYVE domain containing 27 (Zfyve27), (10 ug)


  "NM_199104" in other vectors (3)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfyve27"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Zfyve27
Synonyms MGC72597
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214883 representing NM_199104
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGTCTTCGGATCGGGACCTGAGTGGACCAGAGGCGAGCCCCAGCGTGATGCCTGAGGTTCTCTCTG
AGTGTTCACCTGCCCCTACCAAGTCAACAGCGTTTGATCTTTTCAACCTGGTTCTGTCCTACAAGAGGCT
GGAGATCTACCTGGAACCCCTGAAGGATGCAGGTGACGGTGTTCGATACTTGCTAAGGTGGCAGATGCCT
TTGTGTTCCTTGCTGACTTGCCTGGGCCTCAACATCTTGTTCCTCACTCTGAATGAGGGTGCATGGTACT
CCGTGGGTGCCTTGATAATTTCGGTGCCTGCCCTACTGGGCTACCTTCAGGAGGTGTGCCGGGCACAGCT
ACCAGAGTCTGAGCTGATGAGGCGGAAGTACCACAGCGTGCGGCAGGAAGACCTGCAGAGAGTTCGCCTT
TCCCGCCCTGAGGCTGTAGCTGAGGTGAAAAGCTTCTTGATCCGACTGGAAGCCTTCTTGGCCCGCCTGT
GCTATACCTGCGAGTCAGCTTACCGTGTACTTCACTGGGAGAACCCTGTGGTGTCCTCACAGTTCTATGG
TGCTCTTCTGGGCATGGTTTGCATGCTCTACCTGCTGCCGCTCTGCTGGGTCCTCGCCCTTTTAAACAGC
ACACTCTTTCTGGGAAATGGGGAATTCTTCCGAGTGGTGTCTGAGTACAGGGCTTGTCTGCAGCGGCGGA
TGAGCCCCAAGCAGGAAGAGTGCGTCTGTGAGGGCTCGGCACTGCAGGATGCCGGGGGGAGGGCTGTTGT
ACTGGACAGCACCCCTGCCCCTACACCCACAGAGGACCTCACGCCAGGCAGTGTGGAGGAAGCTGAGGAG
GCTGAGCCAGATGAGGAGTTCAAAGATGCAATAGAGGAGGACGATGAGGGAACCCCATGCCCAGCAGAGG
ATGAGCTGACCATGCAGGACAATGGCTTCCTCAGCAAGAATGAGGTACTGCGCAGCAAGGTGTCGAAGCT
TACAGAGCGGCTCCGCAAGCGCTACCCGACCAACAACTTCGGGAACTGTGCAGGCTGTGCTGCCACCTTC
TCCGTGCTGAAGAAGAGGCGAAGCTGCAGCAACTGTGGGAACAGCTTCTGCTCTCGGTGCTGCTCCTTCA
AGGTGCCCAAGTCCTCCATGGGGGCCACAGCTCCTGAAGCCCAGAGAGAGACTGTGTTTGTGTGTGCCTC
CTGTAATCAGACCTTGAGCAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_199104
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199104.2, NP_954535.2
RefSeq Size 5418 bp
RefSeq ORF 1215 bp
Locus ID 309376
UniProt ID Q6P7B7
Cytogenetics 1q54
Gene Summary Key regulator of RAB11-dependent vesicular trafficking during neurite extension through polarized membrane transport (PubMed:17082457). Promotes axonal elongation and contributes to the establishment of neuronal cell polarity. Involved in nerve growth factor-induced neurite formation in VAPA-dependent manner. Contributes to both the formation and stabilization of the tubular ER network. Involved in ER morphogenesis by regulating the sheet-to-tubule balance and possibly the density of tubule interconnections. Acts as an adapter protein that facilitates the interaction of KIF5A with VAPA, VAPB, SURF4, RAB11A, RAB11B and RTN3 and the ZFYVE27-KIF5A complex contributes to the transport of these proteins in neurons. Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a KIF5A/B-dependent manner (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.