Apoc3 (NM_012501) Rat Untagged Clone
CAT#: RN214203
Apoc3 (untagged ORF) - Rat apolipoprotein C-III (Apoc3), (10 ug)
"NM_012501" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Apoc3 |
Synonyms | apo-CIII; ApoC-III |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214203 representing NM_012501
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGCCCCGAATGCTCCTCATCGTGGCCCTCGTGGCTCTCCTGGCCTCTGCCCGAGCTGATGAGGGAG AGGGATCCTTGCTGCTGGGCTCTATGCAGGGCTACATGGAACAAGCCTCCAAGACGGTCCAGGATGCACT AAGCAGCATGCAGGAGTCTGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCGCTTCAAATCCCTG AAAGGCTACTGGAGCAAGTTCACTGATAAGTTCACTGGCCTCTGGGAGTCTGGCCCTGAGGACCAACTAA CAACACCAACTCTTGAGCCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_012501 |
Insert Size | 303 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012501.2, NP_036633.2 |
RefSeq Size | 536 bp |
RefSeq ORF | 303 bp |
Locus ID | 24207 |
Cytogenetics | 8q22 |
Gene Summary | very low density lipoprotein (VLDL) that comprises a major component of the lipid transport system; increased levels induce hypertriglyceridemia [RGD, Feb 2006] Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214203 | Apoc3 (Myc-DDK-tagged ORF) - Rat apolipoprotein C-III (Apoc3), (10 ug) |
USD 165.00 |
|
RR214203L3 | Lenti ORF clone of Apoc3 (Myc-DDK-tagged ORF) - Rat apolipoprotein C-III (Apoc3), (10 ug) |
USD 465.00 |
|
RR214203L4 | Lenti ORF clone of Apoc3 (mGFP-tagged ORF) - Rat apolipoprotein C-III (Apoc3), (10 ug) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review