Mpv17 (NM_001098240) Rat Untagged Clone

CAT#: RN209276

Mpv17l (untagged ORF) - Rat Mpv17 transgene, kidney disease mutant-like (Mpv17l), nuclear gene encoding mitochondrial protein, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Mpv17
• Synonyms: Mpv17; Mpv17l
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN209276 representing NM_001098240
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCACTCTGGCGAGCATACCAGAGGGCCCTGGCTGCACATCCGTGGAAAGTCCAGGTTCTGACAGCTG
  GGTCACTGATGGGCCTAGGTGACATTATCTCACAGCAGCTGGTGGAAAGGCGGGGTCTCCAGCAACACCA
  GACTGGCCGGACCTTGACCATGGCATCCCTTGGCTGTGGCTTTGTGGGCCCTGTGGTCGGAGGCTGGTAC
  AGGGTTTTGGACCACTTAATCCCCGGCACCACCAAGGTGAATGCACTCAAGAAGATGTTGTTAGATCAGG
  GGGGCTTTGCCCCATGTTTCCTTGGCTGCTTTCTCCCACTGGTAGGGGTACTCAATGGAATGTCAGCCCA
  GGACAATTGGGCCAAACTGAAGCGGGACTACCCCGACGCCCTCATCACCAACTACTATCTCTGGCCTGCT
  GTGCAGTTAGCCAACTTCTACCTGGTCCCCCTGCATTACAGGTTGGCTGTTGTCCAGTGCGTTGCTGTTG
  TCTGGAACTCCTACCTGTCCTGGAAGGCACATCAGCTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001098240
• Insert Size: 531 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001098240.1, NP_001091710.1
• RefSeq Size: 1542 bp
• RefSeq ORF: 531 bp
• Locus ID: 360463
• UniProt ID: Q5BK62
• Cytogenetics: 6q14
• Gene Summary: Involved in mitochondria homeostasis. May be involved in the metabolism of reactive oxygen species and control of oxidative phosphorylation and mitochondrial DNA (mtDNA) maintenance (By similarity).[UniProtKB/Swiss-Prot Function]