Mapre3 (NM_001007656) Rat Untagged Clone

CAT#: RN203870

Mapre3 (untagged ORF) - Rat microtubule-associated protein, RP/EB family, member 3 (Mapre3), (10 ug)


  "NM_001007656" in other vectors (3)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mapre3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mapre3
Synonyms MGC94312
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203870 representing NM_001007656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGTCAATGTGTACTCCACTTCTGTGACCAGTGAGAATCTGAGTCGCCATGATATGCTTGCGTGGG
TCAATGACTCTCTGCACCTCAATTATACCAAGATCGAACAGCTCTGTTCAGGGGCAGCCTACTGCCAGTT
CATGGACATGCTCTTCCCTGGTTGCGTGCACTTGAGGAAGGTCAAGTTCCAGGCCAAGCTAGAACATGAG
TACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTGGACAAAATCATTCCCGTAG
AGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAAATTCTTTGACGC
AAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCACCACCTCCTAAC
CCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCACAGAGGACGTCCCCCA
CAGGCCCCAAGAACATGCAAACCTCTGGCCGACTCAGTAACGTAGCTCCACCCTGCATCCTCCGGAAGAA
TCCCCCCTCAGCCCGAAACGGTGGCCATGAGGCTGATGCCCAGATTCTTGAACTCAACCAGCAGCTGCTG
GACTTGAAGCTGACCGTAGATGGGCTGGAGAAAGAACGGGATTTCTATTTCAGCAAATTGCGAGACATCG
AGCTGATCTGCCAGGAACATGAAAGTGAGAACAGCCCTGTCATCTCGGGCATCATTGGCATTCTCTATGC
CACGGAGGAGGGATTTGCACCCCCTGAGGATGATGAGATTGAAGAACACCAACAGGAAGACCAGGACGAG
TACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007656
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007656.1, NP_001007657.1
RefSeq Size 1845 bp
RefSeq ORF 846 bp
Locus ID 298848
UniProt ID Q5XIT1
Cytogenetics 6q14
Gene Summary Plus-end tracking protein (+TIP) that binds to the plus-end of microtubules and regulates the dynamics of the microtubule cytoskeleton. Promotes microtubule growth. May be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. Also acts as a regulator of minus-end microtubule organization: interacts with the complex formed by AKAP9 and PDE4DIP, leading to recruit CAMSAP2 to the Golgi apparatus, thereby tethering non-centrosomal minus-end microtubules to the Golgi, an important step for polarized cell movement. Promotes elongation of CAMSAP2-decorated microtubule stretches on the minus-end of microtubules (By similarity). May play a role in cell migration (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.