Gnas (NM_019132) Rat Untagged Clone

CAT#: RN200465

Gnas (untagged ORF) - Rat GNAS complex locus (Gnas), transcript variant 3, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Gnas
• Synonyms: ALEX; G-alpha-8; Gnas1; Gnpas; Nesp55; SCG6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200465 representing NM_019132
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTGCCTCGGCAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAGGCGCAGCGCGAGGCCAACA
  AAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTACCGGGCCACGCACCGCCTGCTGCTGCTGGG
  TGCTGGAGAGTCTGGCAAAAGCACCATTGTGAAGCAGATGAGGATCCTACATGTTAATGGGTTTAACGGA
  GAGGGCGGCGAAGAGGACCCGCAGGCTGCAAGGAGCAACAGCGATGGTGAGAAGGCCACCAAAGTGCAGG
  ACATCAAAAACAACCTGAAGGAGGCCATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGT
  GGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACATTCTGAGCGTGATGAACGTGCCAAACTTT
  GACTTCCCACCTGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAGGGAGTTCGTGCCTGCTACG
  AGCGCTCCAACGAGTACCAGCTGATCGACTGTGCCCAGTACTTCCTGGACAAGATTGATGTGATCAAGCA
  GGCCGACTACGTGCCAAGTGACCAGGACCTGCTTCGCTGCCGCGTCCTGACCTCTGGAATCTTTGAGACC
  AAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTGGGCGGCCAGCGCGATGAACGCCGCAAGT
  GGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCAT
  CCGGGAGGACAACCAGACCAACCGTCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGA
  TGGCTGCGTACCATCTCTGTGATCCTCTTCCTCAACAAGCAAGATCTGCTTGCTGAGAAGGTCCTCGCTG
  GGAAATCGAAGATTGAGGACTACTTTCCAGAGTTCGCTCGCTACACCACTCCTGAGGATGCGACTCCCGA
  GCCCGGAGAGGACCCACGCGTGACCCGGGCCAAGTACTTCATCCGGGATGAGTTTCTGAGAATCAGCACT
  GCTAGTGGAGATGGACGTCACTACTGCTACCCTCACTTTACCTGCGCCGTGGACACTGAGAACATCCGCC
  GTGTCTTCAACGACTGCCGTGACATCATCCAGCGCATGCATCTTCGCCAATACGAGCTGCTCTAA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_019132
• Insert Size: 1185 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_019132.1, NP_062005.1
• RefSeq Size: 1738 bp
• RefSeq ORF: 1185 bp
• Locus ID: 24896
• UniProt ID: P63095
• Cytogenetics: 3q43
• Gene Summary: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants have been found for this gene. [provided by RefSeq, Apr 2009]
  Transcript Variant: This variant (3) is biallelically expressed and encodes isoform GNASL, also known as gnas1, a form of the G-protein alpha subunit. Sequence Note: This RefSeq record was created from transcript data from different strains because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.