Dag1 (NM_001276494) Mouse Untagged Clone

CAT#: MC229126

Dag1 (untagged) - Mouse dystroglycan 1 (Dag1), transcript variant 8

USD 845.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dag1 (NM_001276494) Mouse Untagged Clone
Symbol Dag1
Synonyms D9Wsu13e; DG; Dp427; Dp71
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC229126 representing NM_001276494
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTGGACAACTGGCTACTGCACCCCCTCTGGGGACAGACCTTTCTCCTCCTCCTGTCTGTGGCTG
TGGCTCAGGCCCACTGGCCCAGTGAACCCTCAGAGGCTGTGAGGGACTGGAAGAACCAGCTTGAGGCGTC
CATGCACTCAGTTCTCTCCGACTTCCAGGAGGCTGTTCCCACCGTGGTTGGCATTCCAGACGGTACGGCT
GTTGTCGGGCGCTCATTTCGAGTGAGCATTCCAACGGATTTAATTGCCTCCAGTGGGGAGATCATCAAGG
TGTCTGCAGCAGGGAAGGAGGCCTTACCGTCTTGGCTACACTGGGACCCACACAGTCATATTTTGGAAGG
CCTTCCTCTTGACACTGATAAAGGTGTGCATTACATCTCAGTGAGTGCTGCACGCCTGGGAGCCAATGGA
AGCCACGTCCCCCAGACTTCCAGTGTGTTCTCTATCGAGGTCTACCCTGAAGACCACAATGAGCCACAGT
CTGTACGGGCAGCCTCATCAGACCCTGGTGAGGTAGTGCCATCTGCCTGTGCTGCTGATGAGCCAGTGAC
TGTCCTTACAGTGATTCTGGATGCTGACCTCACCAAGATGACCCCAAAGCAAAGGATCGATCTGTTGAAC
AGAATGCAGAGCTTCTCAGAAGTAGAACTTCACAACATGAAGTTGGTGCCTGTAGTGAATAATAGACTAT
TTGACATGTCGGCCTTCATGGCTGGCCCAGGAAATGCAAAGAAAGTGGTAGAGAATGGGGCTCTCCTGTC
CTGGAAACTAGGCTGCTCCTTGAACCAGAATAGCGTCCCTGACATCCGTGGTGTAGAAACCCCTGCTAGG
GAGGGTGCTATGTCTGCCCAACTTGGTTATCCTGTGGTGGGTTGGCACATTGCCAATAAGAAGCCCACTC
TCCCCAAACGACTCCGGAGGCAGATCCACGCCACACCTACACCTGTTACTGCCATTGGACCCCCAACCAC
GGCCATTCAGGAGCCACCATCGCGGATAGTGCCTACGCCTACATCTCCAGCCATTGCACCTCCAACAGAG
ACCATGGCTCCTCCTGTCAGGGATCCTGTTCCAGGGAAGCCCACGGTCACCATTCGGACGCGAGGTGCCA
TTATTCAGACCCCAACTCTGGGCCCTATCCAGCCTACTCGGGTGTCAGAAGCTGGTACCACGGTTCCTGG
CCAGATTCGCCCAACACTGACAATTCCTGGCTATGTAGAGCCCACAGCCGTTATTACTCCTCCAACAACT
ACCACAAAGAAGCCACGAGTGTCCACGCCAAAGCCAGCAACGCCTTCAACTGATTCGTCAACTACCACAA
CTCGGAGGCCAACCAAAAAACCACGGACACCCCGACCAGTGCCCCGAGTCACCACCAAAGCACCCATCAC
CAGGTTGGAGACAGCTTCCCCACCCACTCGAATCCGTACTACCACCAGTGGAGTGCCCCGTGGGGGAGAA
CCTAACCAGCGGCCAGAGCTCAAGAATCACATTGACAGGGTAGATGCCTGGGTGGGAACCTATTTTGAGG
TAAAGATTCCATCAGACACCTTCTATGACAATGAGGATACCACTACCGACAAGCTCAAGCTGACCCTGAA
GCTTCGAGAGCAGCAGTTAGTAGGTGAGAAATCGTGGGTTCAGTTTAACAGCAACAGCCAGCTCATGTAT
GGCCTGCCTGACAGCAGCCATGTGGGAAAACATGAGTATTTTATGCATGCCACAGACAAAGGGGGCCTCT
CCGCTGTGGATGCCTTCGAGATCCATGTTCACAAGCGCCCACAAGGGGACAAGGCTCCTGCACGGTTCAA
GGCCAGGCTTGCAGGGGATCCAGCACCGGTGGTGAATGACATTCACAAGAAAATTGCTTTGGTAAAGAAG
CTAGCTTTTGCTTTTGGGGATCGAAACTGCAGCTCCATCACCCTTCAGAACATCACTCGGGGCTCTATCG
TGGTGGAATGGACCAACAACACTCTGCCCCTGGAGCCCTGCCCCAAGGAGCAGATCATAGGGCTGAGCCG
CAGGATTGCTGATGAAAATGGGAAGCCTCGTCCTGCCTTCTCCAATGCTCTGGAGCCTGACTTTAAGGCT
CTGAGTATTGCTGTGACGGGCTCTGGCAGTTGTCGGCACCTCCAGTTTATCCCTGTGGCACCACCCTCTC
CTGGAAGCTCAGCTGCACCAGCCACAGAGGTTCCAGACAGGGACCCCGAGAAGAGCAGTGAGGACGATGT
TTACCTGCACACCGTTATCCCAGCCGTGGTGGTCGCGGCCATCCTGCTCATTGCTGGAATCATTGCTATG
ATCTGCTATCGCAAGAAGAGGAAGGGCAAGCTGACCCTTGAGGACCAGGCCACCTTTATTAAGAAGGGGG
TGCCTATCATCTTTGCGGATGAGCTGGATGACTCTAAGCCCCCGCCCTCTTCCAGCATGCCGCTCATCTT
GCAGGAAGAGAAGGCTCCCCTCCCACCTCCTGAGTACCCCAACCAGAGTATGCCCGAGACCACTCCTCTG
AACCAGGACACTGTGGGAGAGTACACACCCCTGCGGGATGAGGATCCTAACGCACCTCCCTATCAGCCAC
CCCCACCCTTCACGGCTCCCATGGAGGGCAAGGGCTCCCGTCCCAAGAACATGACCCCATACCGATCACC
CCCTCCGTATGTTCCCCCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001276494
ORF Size 2682 bp
Insert Size 2682
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001276494.1, NP_001263423
RefSeq Size 5430
RefSeq ORF 2682
Locus ID 13138
Cytogenetics 9 F1|9 59.08 cM
Gene Summary This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. A complete lack of the encoded protein in mice results in embryonic lethality due to the disorganization of Reichert's membrane. Chimeric mice deficient in the encoded protein overcome embryonic lethality but develop a progressive muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Nov 2015].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.