Agbl3 (NM_001289657) Mouse Untagged Clone

CAT#: MC228882

Agbl3 (untagged) - Mouse ATP/GTP binding protein-like 3 (Agbl3), transcript variant 3

USD 732.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Agbl3 (NM_001289657) Mouse Untagged Clone
Symbol Agbl3
Synonyms 2900053G10Rik; 4930431N21Rik; 6530406M24Rik; CCP3
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC228882 representing NM_001289657
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCCATTGTTCTATTCTGAAAAAGAGGCCAAAACCCATAACATTGGCTGGCAGAGAATAGGAGATC
AAATCAAGTATTATAAAAATAACCTTGGGCAAGATGGGCGCCATTTTTTTTCTCTTACGTGGACATTTCA
GTTTCCACACAGCCAGGATACGTGCTACTTTGCTCACTGCTATCCATACACTTACTCCAACCTTCAAGAA
TACCTGTCTGGCATCAACAGTGACCCAGTAAGATCAAAGTTTTGTAAAATACGTGTCTTGTGTCACACAC
TTGCCAGGAATATGGTGTATGTCTTGACAATAACTACTCCCTTGAAGACTAGTGACTCAAAGCGCAAGGC
TGTGATTTTGACTGCAAGGGTCCATCCAGGAGAGACCAACAGCTCTTGGATCATGAAAGGCTTCCTGGAT
TATATTTTAGGAGACTCAAGTGATGCACGCTTGCTTCGGGACACTTTCATCTTCAAGGTGGTACCCATGC
TGAATCCAGATGGCGTGATTGTGGGAAATTATCGATGTTCCTTAGCTGGACGGGATTTAAACCGTAATTA
CACATCGCTCCTGAAGGAGTCTTTCCCTTCTGTTTGGTATACAAGGAACATGATCAATAGGTTAATGGAG
AAACGAGAGGTTATTTTATATTGTGATCTTCATGGCCATAGTAGGAAACAGAATATTTTCATGTATGGTT
GTGATGGTAGCAGCAGATCTAAAACAAAAGGATTATACTTACAGCAACGGATCTTTCCACTCATGCTGAG
CAAAAATTGCCCAAATATATTTTCCTTCTCAGCTTGCAAGTTTAACGTTCAGAAAAGCAAAGAGGGGACA
GGAAGGGTTGTAATGTGGAAGATGGGCATCAGGAACAGCTTCACGCTGGAGGCCACCTTCTGCGGATCTA
CTCTGGGCAATAAACGAGGCACTCATTTCGGCACAAAAGATTTAGAGTCGATGGGATATCATTTTTGTGA
TTCTCTGTTGGACTACTGTGATCCTGACAGGAGCAAATATTATCAGTGCTTGAAAGAATTAGAAGAAATG
GAGAAACATTTGAGCTCCGAAAGAGTCTCTGATAACACAGATACTTCTCTAGTAGAAATTTCTTTGGATG
TAGAGTCTAGTAGTCGAGGCTCTGACAGCTCAGAGTCCAATGACACTCAGACTTACCTTCTCAAGGTGAC
CTCTCAGGCAAGAAACAAGAAAAAGTATCTGAAAACAAAGAGGGAAAGAAATGCCATCCTAGCAAACTGC
CAGAATAACATGCAAGAGGTTTATGGCAAAGAACATTTACTCCAAAGACACGATGAATCAAATTCTGATG
GGAATGATCCAAGGATAGATGCACCAGATGTTTATGTGGCTCACTGTTTCAGAAGACCGTTGCCTAACCA
AGGCGTGGTGAAAATTCCTGGACAAAGGTTTTATCCCGGAAAAACATGGTCCAGCTCCCAGCGTATGATT
AAGAGTCTTAACAAAGACCATAGGACATGTATTTTAGAAACTTGTAAGAATCCAATCCAGGAAGTTCAGT
CCAGAGGAATCAATATACATGAAAGTTGTTTCAAAATGGCGAAATGTCCTATGAACAAAAGACCTTCACA
TTGGATTGAGAAGACAAGAATACCAACAGAGTCACATCACCAGTTGAAAAGCAAAGCAAAAAGATGCTCG
TCTTTCCAAAGCAAGAGGACTGGGACGAATTGGACAGATGATGAGAAACGAATTTACAGGGATAAAAGAA
TAGCTCAAACTCAGGAAATATTAAAGTATTTACTCCCTATCGTGGAGTCCTCTCAAAACAGGAAATCTAC
TCAAATGAACAATCTAATCAACCCGATAGCCAACTTGCAACAGCATCAACTTATTCCAACTGCTTGCATA
AATAGAAGAAGATACAGCATACCTTGGACACCAACCAGAAATCTCCCTTTTAAAGCCCAAAGGAATCTTA
TGACAGACACCTCCGAATGGCTCCAGTCTGTGCCCCTTGGGTCATTTGAAAGTTTGTTACCTCTCTGCAA
TCTTCAGAAGAAGACAAAACATTTTGAACTCTGGGGCAAAAAGGCTAAGGATGTGCAGCTTGCCACCAGC
CAATGGGAGGCTGTGCCCTTGAGTTCTAACATGGATGCAAGTATCATCAGGGGTAACAGTGTTCTGCAGC
CTAAAGAATTCACCATGAGGAGCTCTAAGCAGAGAATTCCTTACCTAACCAAAACCAGCAAGAAACCCAG
TGAGAGTGATGGCCTGCTCACCTTCCAGCTGAAGATTCACAGGAACAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289657
ORF Size 2292 bp
Insert Size 2292
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289657.1, NP_001276586
RefSeq Size 5235
RefSeq ORF 2292
Locus ID 76223
Cytogenetics 6|6 B1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.