Pip5k1a (NM_001293707) Mouse Untagged Clone

CAT#: MC228253

Pip5k1a (untagged) - Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha (Pip5k1a), transcript variant 1


  "NM_001293707" in other vectors (1)

Reconstitution Protocol

USD 561.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pip5k1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pip5k1a
Synonyms PI4P5K-I[a]; PIP5K1-alpha; PIP5KIalpha; Pipk5a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228253 representing NM_001293707
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCCGCCTCCTCAGGGCCAGCGGCGGCCGGGTTTTCATCCCTTGATGCCGGGGCCCCTGCTGGTA
CCGCAGCAGCAGCATCTGGAATCAAGAGAGCCACAGTATCTGAGGGACCTTCCGCCTCTGTCATGCCTGT
TAAAAAAATAGGCCATCGAAGTGTTGATTCCTCTGGAGAGACTACATACAAGAAGACAACTTCATCAGCC
TTGAAAGGTGCCATCCAGTTAGGCATCACTCACACTGTGGGCAGCCTGAGCACCAAACCAGAGCGTGATG
TCCTCATGCAAGACTTCTACGTGGTGGAGAGCATCTTTTTCCCCAGTGAAGGCAGCAACCTGACACCGGC
TCACCATTACAATGACTTTCGATTCAAGACCTATGCGCCTGTTGCCTTCCGTTACTTCAGAGAGCTCTTT
GGCATCCGGCCTGATGATTACTTGTACTCCCTTTGCAGTGAGCCATTGATTGAACTCTCCAATTCTGGAG
CTAGTGGTTCCCTCTTCTATGTGTCCAGTGATGATGAATTCATCATTAAGACCGTCCAGCATAAAGAAGC
AGAATTTCTGCAGAAGTTGCTTCCAGGATACTACATGAATCTTAACCAAAACCCTCGTACTTTGCTGCCC
AAATTTTATGGATTGTACTGTGTGCAAGCAGGCGGCAAGAACATACGAATTGTGGTGATGAACAATCTCT
TGCCTCGGTCAGTCAAAATGCATATGAAATATGACCTGAAGGGTTCAACTTACAAGCGGCGGGCTTCTCA
GAAAGAACGAGAGAAAACTCTCCCCACCTTTAAAGACCTGGACTTCCTACAAGATATCCCTGACGGCCTA
TTTTTGGATGCTGACATGTACAGTGCTCTGTGTAAGACTCTACAGCGTGACTGTTTGGTGCTGCAGAGCT
TCAAGATAATGGACTACAGCCTGTTGATGTCCATCCACAACATGGACCATGCACAGAGGGAGCCCACGAG
CAATGACACACAGTACTCGGCTGACACGCGCAGACCAGCCCCACAGAAGGCGCTCTATTCCACAGCTATG
GAATCCATCCAGGGCGAGGCTCGACGGGGCGGCACTGTGGAGACTGAGGACCACATGGGTGGCATCCCTG
CCCGGAATAACAAAGGAGAAAGGCTCCTGCTTTATATTGGCATCATTGATATTCTTCAGTCCTACAGGTT
TGTTAAGAAGTTGGAGCACTCTTGGAAAGCACTGGTCCATGATGGGGATACGGTGTCAGTGCATCGTCCA
GGCTTCTATGCTGAGCGGTTCCAGCGTTTCATGTGCAACACAGTGTTCAAGAAGATTCCCTTGAAGCCTT
CTCCTACCAAAAAGTTTCGGTCTGGCCCGTCTTTCTCTCGGCGATCAGGCCCCAGCGGCAACTCCTGCAC
CTCCCAGCTGATGGCCTCTGGGGAACACAGAGCACAAGTGACCACCAAGGCGGAAGTGGAGCCAGATGTA
CACCTTGGGCGTCCTGATGTCTTACCTCAGACTCCACCTTTGGAGGAAATAAGTGAGGGTTCACCTGTTC
CTGGCCCCAGTTTCTCACCTGTAGTTGGACAACCTTTGCAAATACTAAATTTGAGTTCAACCTTGGAAAA
GCTTGATGTTGCAGAGTCAGAGTTCACCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293707
Insert Size 1644 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293707.1, NP_001280636.1
RefSeq Size 3676 bp
RefSeq ORF 1644 bp
Locus ID 18720
UniProt ID P70182
Cytogenetics 3 F2.1
Gene Summary Catalyzes the phosphorylation of phosphatidylinositol 4-phosphate (PtdIns4P) to form phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). PtdIns(4,5)P2 is involved in a variety of cellular processes and is the substrate to form phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3), another second messenger. The majority of PtdIns(4,5)P2 is thought to occur via type I phosphatidylinositol 4-phosphate 5-kinases given the abundance of PtdIns4P. Participates in a variety of cellular processes such as actin cytoskeleton organization, cell adhesion, migration and phagocytosis. Required for membrane ruffling formation, actin organization and focal adhesion formation during directional cell migration by controlling integrin-induced translocation of RAC1 to the plasma membrane. Together with PIP5K1C is required for phagocytosis, but they regulate different types of actin remodeling at sequential steps. Promotes particle ingestion by activating WAS that induces Arp2/3 dependent actin polymerization at the nascent phagocytic cup. Together with PIP5K1B is required after stimulation of G-protein coupled receptors for stable platelet adhesion. Plays a role during calcium-induced keratinocyte differentiation. Recruited to the plasma membrane by the E-cadherin/beta-catenin complex where it provides the substrate PtdIns(4,5)P2 for the production of PtdIns(3,4,5)P3, diacylglycerol and inositol 1,4,5-trisphosphate that mobilize internal calcium and drive keratinocyte differentiation. Together with PIP5K1C have a role during embryogenesis. Functions also in the nucleus where acts as an activator of TUT1 adenylyltransferase activity in nuclear speckles, thereby regulating mRNA polyadenylation of a select set of mRNAs (PubMed:10679324, PubMed:18772378, PubMed:19153220, PubMed:20622009, PubMed:8798574). Positively regulates insulin-induced translocation of SLC2A4 to the cell membrane in adipocytes (PubMed:27739494).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.