Klc3 (NM_001286038) Mouse Untagged Clone

CAT#: MC228091

Klc3 (untagged) - Mouse kinesin light chain 3 (Klc3), transcript variant 1

USD 485.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Klc3 (NM_001286038) Mouse Untagged Clone
Symbol Klc3
Synonyms BC017147; Klct
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC228091 representing NM_001286038
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTGCAGGTGGCAGCCCCTGGAAGCACAGGGCTGGGCCCAGAACGCCTGAACCCCGAGGAGCTGG
TGCGGCAGACACGACAGGTTGTACAGGGACTGGAGGCCCTGCGGGCCGAGCACCATAGTCTGGCTGGGCA
CCTGGCGGAGGCCCTGGCTGGACCAGGCCCTGTGGCTGGTGTGGAGCTGCTGGAAGAGAAGCAACAGGTG
GTGAACCACTCGCTGGAGGCCATCGAGCTGGGGCTGGGTGAGGCCCAGGTGCTGCTGGCCCTGTCCGCAC
ACGTGAGTGTGTTGGAGGCTGAGAAGCAGAGGCTACGGGCACAGGCACGGAGGCTAGCCCAAGAGAACAC
ATGGCTTCGAGAGGAGCTGGAGGAGACACAGAGGCGACTGCGGGCCAGCGAGGAGGCTGTGGCCCAGCTG
GAAGAGGAGAAGAGCCACCTCCAGTTCCTGGGGCAGCTGAGGCAGTATGACCCGCCCGAGGAGAGCCAGA
GGCCCGAGTCCCCCCCTCGCCGAGACAGCTTGGCATCTCTGTTCCCCAGTGAAGAGGAGGAAAAGAAAGG
TCCTGAGGCAGCAGGAGCAGCAGCCGCGCAGCAGGGTGGCTATGAGATCCCAGCTCGTCTGCGGACCCTG
CACAACCTGGTGATCCAGTATGCTGGCCAGGGCCGCTATGAGGTGGCAGTTCCCCTATGTCGCCAGGCTC
TGGAGGACCTGGAGCGGAGCTCGGGCCACTGCCATCCTGACGTGGCCACCATGCTCAACATCCTGGCACT
CGTGTACAGGGACCAGAACAAATACAAGGAAGCTACGGAGCTTCTTCACGACGCCCTGCAGATCCGGGAA
CAGACGCTGGGTCCTGAACACCCTGCAGTGGCTGCCACCCTCAACAACCTGGCTGTCCTCTATGGAAAAC
GTGGACGTTACCGGGAGGCAGAACCCCTCTGCCAGCGTGCTCTGGAGATCCGTGAGAAGGTCCTGGGTGC
AGACCACCCTGATGTGGCCAAGCAGCTCAACAACCTGGCCCTACTGTGCCAGAACCAGGGCAAGTTTCAG
GACGTGGAGCGGCACTATGCGCGGGCCCTGAGCATCTACGAGGCCCTGGGCGGGCCACAGGACCCAAATG
TGGCCAAGACTAAGAACAACCTGGCCTCAGCCTACCTGAAACAGAACAAGTATCAGCAGGCAGAGGAGCT
ATACAAGGAGATCCTCAGCCAGGAGGCCCTGCCCGCCCCACTTGGAGCCCCCCAGGGAGGCACAGCAGGC
GATACACAGCAGCAGGTCCTGCGCAGGAGCAGTTCCTTCTCTAAGCTCCGGGAATCCATCAGGCGAGGAA
GCGAGAAGCTGGTCTCCCGCCTCCGAGGAGAGGGCATGGCAGGGGCTGCCGGGATGAAGAGAGCCATGTC
ACTCAATATGCTGAACGTGGATGGTCCCAGGGCTGCCCGGACGCAGCTCTCCCAGCTCTCAACCCGGCAC
CTGAGTGAGGCCCCTCGGACCCTGAGCATCAGCACACAAGATCTGAGCCCGCGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001286038
ORF Size 1527 bp
Insert Size 1527
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001286038.1, NP_001272967
RefSeq Size 1944
RefSeq ORF 1527
Locus ID 232943
Cytogenetics 7 A3|7 9.62 cM
Gene Summary Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.