Rbck1 (NM_019705) Mouse Untagged Clone

CAT#: MC228090

Rbck1 (untagged) - Mouse RanBP-type and C3HC4-type zinc finger containing 1 (Rbck1), transcript variant 2


  "NM_019705" in other vectors (2)

Reconstitution Protocol

USD 521.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rbck1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rbck1
Synonyms AL033326; HOIL-1; HOIL-1L; Ubce7ip3; UIP28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228090 representing NM_019705
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGAAGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTTGCCCGGGCAGTGGCTGGCGGAGATG
AACAGGCTGCTATCAAGTATGCCACCTGGCTGGCAGAGCAGAGGGTGCCCCTCAGGGTGCAAGTAAAACC
CGAGGTCTCCCCAACACAGGACATCAGGCTCTGTGTGAGTGTGGAGGATGCGTACATGCACACCGTCACC
ATTTGGCTCACAGTACGCCCGGATATGACAGTGGCCTCCCTTAAGGACATGGTATTCCTGGACTATGGCT
TCCCACCTAGCCTGCAGCAGTGGGTGGTTGGACAGAGGCTGGCACGAGACCAGGAGACCTTGCATTCACA
CGGCATTCGGCGGAATGGAGACGGTGCCTATCTCTACCTGCTGTCAGCCCGCAACACGTCACTCAACCCA
CAAGAGCTGCAGCGGCAGCGGCAACTGCGAATGTTGGAAGATTTGGGCTTCAAGGACCTCACCCTTCAGT
CACGGGGGCCCTTGGAACCTGTCCTTCCGAAGCCCAGGACCAACCAGGAGCCGGGACAGCCAGATGCAGC
ACCGGAGTCACCACCGGTGGGCTGGCAGTGCCCTGGCTGCACTTTCATCAACAAACCCACACGGCCTGGG
TGTGAGATGTGCTGTCGTGCAAGGCCTGAGACCTACCAGATACCTGCTTCATACCAGCCTGACGAGGAAG
AGCGAGCACGCCTGGCCGGCGAGGAGGAGGCGCTGCGCCAGTACCAGCAGCGGAAACAGCAGCAGCAGGA
GGGGAACTACCTGCAGCACGTGCAGCTGGAGCAGAGGAGCCTGGTGCTGAACACCGAACCTACTGAGTGC
CCTGTGTGCTACTCAGTGCTGGCACCCGGCGAGGCCGTGGTGCTGCGTGAGTGTCTGCACACCTTCTGCA
GGGAGTGCCTGCAGGGCACCATCCGAAACAGCCAGGAGGCGGAGGTGGCTTGCCCCTTCATTGACAGCAC
CTACTCATGCCCCGGCAAGCTGCTGGAGAGAGAGATCCGGGCGCTCCTGTCCCCTGAGGACTACCAGCGT
TTCCTGGATCTGGGTGTGTCCATCGCAGAGAACCGAAGCACCTTGAGCTACCACTGCAAGACCCCCGACT
GCAGGGGTTGGTGCTTCTTTGAGGATGATGTCAACGAGTTCACCTGTCCTGTGTGCACCCGTGTCAACTG
CCTGCTCTGCAAGGCCATCCATGAGCACATGAATTGCAGGGAGTACCAAGACGACCTGGCCCTGCGGGCT
CAGAATGATGTGGCTGCCCGGCAGACGACAGAGATGCTAAAGGTAATGCTGCAGCAGGGCGAGGCCATGC
ACTGCCCACAGTGCCGGATTGTGGTGCAGAAGAAGGACGGCTGTGACTGGATCCGCTGTACAGTCTGCCA
CACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCAGGGGGCCCAGGGGACACCAGTGGTGGC
TGCCGCTGCCGGGTCAATGGGATTCCATGCCACCCAAGCTGTCAAAACTGCCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019705
Insert Size 1527 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019705.3, NP_062679.2
RefSeq Size 2251 bp
RefSeq ORF 1527 bp
Locus ID 24105
UniProt ID Q9WUB0
Cytogenetics 2 G3
Gene Summary E3 ubiquitin-protein ligase, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, such as UBE2L3/UBCM4, and then transfers it to substrates. Functions as an E3 ligase for oxidized IREB2 and both heme and oxygen are necessary for IREB2 ubiquitination. Promotes ubiquitination of TAB2 and IRF3 and their degradation by the proteasome. Component of the LUBAC complex which conjugates linear ('Met-1'-linked) polyubiquitin chains to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF-induced cell death and thereby prevents inflammation. LUBAC is recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Together with OTULIN, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis. Binds polyubiquitin of different linkage types (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.