Mavs (NM_001206385) Mouse Untagged Clone

CAT#: MC228071

Mavs (untagged) - Mouse mitochondrial antiviral signaling protein (Mavs), transcript variant 2


  "NM_001206385" in other vectors (1)

Reconstitution Protocol

USD 516.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mavs"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mavs
Synonyms cardif; D430028G21Rik; IPS-1; Visa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228071 representing NM_001206385
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACATTTGCTGAGGACAAGACCTATAAGTATATCCGAGACAACCACAGCAAGTTTTGCTGTGTTGACG
TTCTGGAGATCCTGCCTTACCTGTCCTGCCTCACAGCTAGTGACCAGGATCGACTGCGGGCTTCCTACAG
GCAGATCGGGAACCGGGACACACTCTGGGGACTCTTCAATAATCTCCAGCGCCGGCCTGGCTGGGTGGAG
GTCTTCATCCGGGCACTGCAGATCTGTGAGCTGCCTGGGCTGGCTGATCAAGTGACTCGAGTTTATCAGA
GCTACCTGCCTCCGGGGACCTCACTCCGCTCCCTAGAGCCACTGCAGTTACCAGACTTTCCTGCTGCGGT
TTCTGGACCCTCTGCATTTGCGCCAGGTCACAACATCCCTGACCATGGCTTACGAGAGACACCAAGTTGC
CCCAAGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCAGTAGAGAATTCAGAGCAACTCCTCCAGACCA
ACTCCGGGGCCGTCGCGAGGATGTCTGGTGGCTCTTTGATACCCTCTCCTAACCAGCAGGCTCTCAGCCC
TCAGCCCTCCAGAGAGCATCAAGAGCAAGAACCAGAACTGGGTGGCGCCCACGCAGCAAATGTTGCCTCT
GTTCCCATAGCAACCTATGGACCTGTGTCTCCAACCGTTTCCTTCCAGCCCCTTCCACGTACTGCCCTGA
GGACAAACCTCTTGTCTGGGGTCACAGTATCAGCCCTATCTGCTGATACCTCTTTGTCCTCCTCGTCCAC
TGGATCAGCTTTTGCAAAGGGAGCTGGTGACCAGGCCAAAGCTGCCACCTGTTTCAGTACTACACTCACC
AATTCTGTGACTACCAGCTCAGTGCCTTCTCCCAGATTGGTCCCAGTAAAAACCATGTCTTCCAAGTTGC
CCCTCAGTTCAAAGTCCACTGCTGCGATGACGTCTACTGTGCTCACCAATACAGCGCCATCAAAATTACC
CAGCAACTCAGTGTATGCGGGCACAGTGCCATCCAGAGTGCCTGCTAGTGTGGCCAAAGCACCTGCCAAC
ACAATACCACCTGAGAGGAACAGCAAGCAAGCCAAGGAGACCCCGGAGGGTCCAGCAACCAAAGTCACCA
CTGGAGGCAACCAGACTGGACCAAATAGCAGTATCAGGAGCTTGCACTCTGGACCAGAGATGAGCAAGCC
AGGTGTGCTGGTATCCCAGTTGGACGAGCCATTCTCAGCCTGCTCTGTGGACCTTGCCATTAGCCCTAGC
AGCTCCTTGGTCTCAGAACCCAACCATGGTCCAGAGGAGAATGAGTATTCGTCCTTTAGAATCCAGGTAG
ACGAAAGCCCCAGTGCTGATCTATTAGGAAGCCCTGAGCCACTAGCCACCCAGCAGCCCCAAGAAGAGGA
AGAACATTGTGCCAGTTCAATGCCCTGGGCTAAGTGGCTTGGGGCCACCAGTGCACTCTTGGCTGTATTC
CTGGCAGTGATGCTGTACCGTAGTAGGCGCCTGGCCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001206385
Insert Size 1512 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206385.1, NP_001193314.1
RefSeq Size 2871 bp
RefSeq ORF 1512 bp
Locus ID 228607
UniProt ID Q8VCF0
Cytogenetics 2 F1
Gene Summary Required for innate immune defense against viruses (PubMed:24037184). Acts downstream of DHX33, DDX58/RIG-I and IFIH1/MDA5, which detect intracellular dsRNA produced during viral replication, to coordinate pathways leading to the activation of NF-kappa-B, IRF3 and IRF7, and to the subsequent induction of antiviral cytokines such as IFN-beta and RANTES (CCL5) (PubMed:24037184). Peroxisomal and mitochondrial MAVS act sequentially to create an antiviral cellular state (By similarity). Upon viral infection, peroxisomal MAVS induces the rapid interferon-independent expression of defense factors that provide short-term protection, whereas mitochondrial MAVS activates an interferon-dependent signaling pathway with delayed kinetics, which amplifies and stabilizes the antiviral response (By similarity). May activate the same pathways following detection of extracellular dsRNA by TLR3 (By similarity). May protect cells from apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.