Abi2 (NM_001198571) Mouse Untagged Clone

CAT#: MC227911

Abi2 (untagged) - Mouse abl-interactor 2 (Abi2), transcript variant 2


  "NM_001198571" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Abi2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Abi2
Synonyms 8430425M24Rik; AI839867; C130078H13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227911 representing NM_001198571
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGCTGCAGATGCTGCTGGAAGAGGAAATCCCGGGGGGCCGCCGGGCTCTCTTCGACAGCTACA
CGAATCTGGAGCGGGTGGCCGACTACTGCGAGAATAACTACATCCAGTCACCAGATAAGCAGCGAGCCCT
AGAAGAAACCAAAGCCTACACCACTCAATCCTTAGCAAGTGTTGCGTATCTGATAAACACCTTGGCCAAC
AATGTCCTACAGATGCTGGATATCCAGGCATCACAGTTACGGAGGATGGAGTCTTCAATCAACCATATTT
CACAAACAGTTGATATTCATAAAGAGAAGGTTGCAAGAAGAGAAATTGGTATTTTGACCACCAATAAAAA
CACTTCAAGGACCCATAAGATTATTGCGCCAGCCAACCTTGAGCGGCCAGTTCGTTATATTCGAAAACCT
ATTGACTACACAATTTTAGATGACATTGGACATGGAGTGAAGTGGTTGCTTAGATTTAAGGTGAGTACCC
AGAATATGAAAATGGGTGGATTGCCACGTACGACACCTCCAACTCAGAAGCCCCCAAGTCCCCCTATGTC
AGGGAAGGGGACACTTGGGCGGCACTCCCCCTATCGAACACTGGAGCCAGTGCGTCCTCCAGTGGTACCA
AATGATTACGTACCTAGCCCAACCCGTAATATGGCTCCCTCGCAGCAGAGCCCTGTGAGGACAGCTTCTG
TGAATCAAAGAAATCGAACTTACAGCAGCAGTGGGAGCAGTGGAGGAAGTCACCCAAGTAGTCGGAGCAG
CAGTCGGGAGAACAGCGGAAGTGGTAGTGTGGGGGTACCCATTGCTGTGCCTACTCCGTCTCCTCCAAGC
GTCTTTCCAGACGCTGCTGCTGGGGGTGCACAGAGCCTTGCTGATGGCTTCACTTCTCCAACTCCCCCTG
TTATTTCTTCTAACCCCCCCACAGGTCATCCTGTTCAGTTCTACAGCATGAACAGGCCTGCCTCTCGCCA
TACACCACCTACAATAGGGGGCTCGTTGCCCTATAGACGTCCTCCTTCCATAACGTCACAAACAAGCCTT
CAGAATCAGATGAATGGAGGTCCTTTTTATAACCAGAATCCAGTTTCAGATACACCACCTCCACCCCCAC
CTGTGGAAGAGCCAGTCTTTGATGAATCCCCCCCTCCACCGCCTCCTCCAGAAGATTATGAAGAGGAGGA
AGCAGCTGTGGTTGAGTACAGCGATCCGTACGCTGAAGAGGACCCACCGTGGGCGCCAAGGGCTTACTTG
GAAAAGGTTGTGGCAATTTATGATTATACAAAAGACAAGGAAGATGAGCTGTCCTTTCAGGAAGGAGCCA
TTATATATGTCATCAAGAAGAATGACGATGGTTGGTATGAGGGAGTTATGAATGGTGTGACCGGGCTCTT
CCCTGGGAACTATGTTGAGTCCATCATGCATTATTCGGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001198571
Insert Size 1443 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001198571.1, NP_001185500.1
RefSeq Size 5892 bp
RefSeq ORF 1443 bp
Locus ID 329165
UniProt ID P62484
Cytogenetics 1 C2
Gene Summary Regulator of actin cytoskeleton dynamics underlying cell motility and adhesion. Functions as a component of the WAVE complex, which activates actin nucleating machinery Arp2/3 to drive lamellipodia formation (By similarity). Acts as regulator and substrate of nonreceptor tyrosine kinases ABL1 and ABL2 involved in processes linked to cell growth and differentiation. Positively regulates ABL1-mediated phosphorylation of ENAH, which is required for proper polymerization of nucleated actin filaments at the leading edge (By similarity). Contributes to the regulation of actin assembly at the tips of neuron projections. In particular, controls dendritic spine morphogenesis and may promote dendritic spine specification toward large mushroom-type spines known as repositories of memory in the brain (PubMed:15572692). In hippocampal neurons, may mediate actin-dependent BDNF-NTRK2 early endocytic trafficking that triggers dendrite outgrowth (PubMed:27605705). Participates in ocular lens morphogenesis, likely by regulating lamellipodia-driven adherens junction formation at the epithelial cell-secondary lens fiber interface (PubMed:15572692). Also required for nascent adherens junction assembly in epithelial cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.