Apbb1 (NM_001253887) Mouse Untagged Clone

CAT#: MC227765

Apbb1 (untagged) - Mouse amyloid beta (A4) precursor protein-binding, family B, member 1 (Apbb1), transcript variant 3


  "NM_001253887" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-Apbb1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Apbb1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Apbb1
Synonyms Fe65; Rir
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227765 representing NM_001253887
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGGTACAGGACACCTCAGGGACCTACTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCCC
CAGGCCGGGCCTCCCCCTCACAGGGGAGCAGCCCCCAAGAAGAGTCCCAGCTCACCTGGACTGGCTTTGC
TCACCAAGAAGGCTTTGAGGAAGGAGAGTTTTGGAAGGATGAACCCAGTGAGGAGGCCCCAATGGAGTTG
GGACTGAAGGACCCCGAGGAGGCGACATTGTCCTTCCCAGCTCAGAGCCTCAGCCCAGAACCAGTTCCCC
AGGAGGAAGAGAAGCTGTCCCAACGGAATGCCAACCCAGGGATCAAGTGTTTCGCTGTGCGCTCCCTAGG
CTGGGTAGAGATGACCGAGGAGGAGCTGGCCCCAGGACGCAGCAGTGTGGCAGTCAACAATTGTATCCGC
CAGCTCTCCTACCACAAAAACAATCTACATGATCCGATGGCTGGGGGCTGGGGAGAGGGAAAGGATCTGC
TGCTCCAGCTGGAGGACGAGACTCTAAAGTTGGTGGAGCCACAGAACCAGACGCTGCTGCATGCACAGCC
CATCGTCAGCATTCGTGTGTGGGGCGTTGGGCGGGACAGTGGAAGAGAGAGGGACTTTGCCTACGTAGCT
CGAGATAAGCTGACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAGAACATCGCCA
CCAGCCTGCATGAGATCTGCTCCAAGATCATGTCTGAACGGCGCAATGCTCGCTGCTTGGTCAATGGACT
CTCCCTAGACCACTCTAAACTCGTGGATGTCCCTTTCCAAGTGGAATTCCCAGCACCAAAGAATGAGCTG
GTGCAGAAGTTCCAAGTCTATTACCTGGGAAATGTGCCAGTTGCTAAACCTGTTGGGGTAGACGTGATTA
ATGGGGCCCTGGAGTCAGTCCTGTCTTCCAGTAGCCGTGAGCAGTGGACTCCAAGTCACGTCAGCGTGGC
CCCTGCCACCCTCACCATCTTGCACCAGCAGACAGAAGCGGTGCTGGGGGAGTGCCGGGTGCGGTTTCTC
TCCTTCCTGGCTGTGGGCAGAGATGTGCACACATTCGCGTTCATCATGGCTGCCGGCCCAGCCTCCTTCT
GCTGTCACATGTTTTGGTGTGAGCCCAATGCTGCCAGTCTCTCAGAGGCTGTGCAGGCTGCATGCATGCT
CCGCTACCAGAAGTGTCTGGATGCTCGCTCCCAGACCTCCACCTCCTGCCTCCCAGCACCCCCTGCGGAG
TCAGTTGCAAGACGTGTAGGGTGGACAGTCCGCAGGGGTGTTCAGTCGCTGTGGGGTTCCCTCAAGCCCA
AACGTCTGGGATCCCAGACCCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253887
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253887.1, NP_001240816.1
RefSeq Size 1922 bp
RefSeq ORF 1356 bp
Locus ID 11785
Cytogenetics 7 55.9 cM
Gene Summary Adapter protein that forms a transcriptionally active complex with the gamma-secretase-derived amyloid precursor protein (APP) intracellular domain. Plays a central role in the response to DNA damage by translocating to the nucleus and inducing apoptosis. May act by specifically recognizing and binding histone H2AX phosphorylated on 'Tyr-142' (H2AXY142ph) at double-strand breaks (DSBs), recruiting other pro-apoptosis factors such as MAPK8/JNK1. Required for histone H4 acetylation at double-strand breaks (DSBs). Its ability to specifically bind modified histones and chromatin modifying enzymes such as KAT5/TIP60, probably explains its transcription activation activity. Function in association with TSHZ3, SET and HDAC factors as a transcriptional repressor, that inhibits the expression of CASP4. Associates with chromatin in a region surrounding the CASP4 transcriptional start site(s).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.