Brap (NM_001289543) Mouse Untagged Clone

CAT#: MC227727

Brap (untagged) - Mouse BRCA1 associated protein (Brap), transcript variant 2


  "NM_001289543" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Brap"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Brap
Synonyms 3010002G07Rik; BRAP2; IMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227727 representing NM_001289543
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTCCCTAAAAGAAGACGTTCGGCGCAGTGCCATGCTGTGTGTCCTCACCGTCCCTGCCACCATGA
CCAGTCATGACCTTATGAAGTTTGTTGCCCCATTCAATGATGTAATTGAACAAATGAAAATCATCAGGGA
CTCTACTCCGAATCAGTACATGGTACTGATCAAGTTCAGTGCGCAGGCTGATGCAGACAGTTTCTACATG
GCGTGCAATGGCCGCCAGTTCAACTCAATCGAAGATGACGTCTGCCAGCTGGTCTATGTGGAAAGGGCTG
AAGTGCTGAAATCTGAAGATGGCGCCAGCCTCCCCGTGATGGACCTGACGGAGCTGCCCAAGTGCACTGT
GTGTCTGGAGCGGATGGACGAGTCTGTGAATGGCATCCTCACCACCCTCTGCAACCACAGCTTCCATAGT
CAGTGTCTGCAGCGGTGGGATGACACCACGTGTCCTGTGTGCCGATACTGTCAAACGCCAGAGCCAGTGG
AAGAAAACAAATGTTTTGAGTGTGGTGTCCAGGAAAACCTCTGGATTTGTTTAATATGCGGCCACATAGG
CTGTGGGCGGTACGTGAGTCGGCATGCTTACAAGCACTTTGAGGAGACCCAGCACACATACGCCATGCAG
CTCACCAACCATCGAGTCTGGGACTATGCTGGAGATAATTATGTCCATCGACTGGTTGCAAGCAAGACGG
ATGGAAAGATCGTTCAGTACGAGTGTGAGGGCGACACCTGCCAGGAAGAGAAGATAGATGCCTTACAGTT
AGAGTACTCGTACCTGTTGACAAGCCAGCTGGAATCGCAGCGGATATACTGGGAGAACAAAATCGTGCGC
ATAGAGAAGGACACGGCAGAGGAGATTAACAACATGAAGACCAAGTTTAAAGAGACCATCGAGAAGTGTG
ACAGCCTGGAGCTCAGGCTCAGTGACCTCCTGAAGGAGAAGCAGTCTGTGGAAAGGAAGTGTACCCAGCT
GAACACCAGAGTGGCCAAGCTCAGCACGGAGCTGCAGGAGGAGCAGGAGCTGAACAAGTGTCTGCGCGCC
AACCAGCTGGTGCTGCAGAACCAGCTCAAGGAGGAGGAGAAGCTGCTGAAGGAGACCTGTGCCCAGAAAG
ACCTGCAGATCACCGAGATCCAGGAGCAGCTGCGCGATGTCATGTTCTACCTGGAGACACAGCAGCAGAT
CAGCCACCTGCCTGCGGAGACGAGGCAGGAGATCCAGGAAGGCCAGATCAACATCGCCATGGCCTCAGCG
CCCAACCCACCCTCTTCCGGGGCCGGTGGGAAGCTGCAGTCCAGAAAGGGCCGCAGCAAGAGGGGCAAGT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289543
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289543.1, NP_001276472.1
RefSeq Size 3541 bp
RefSeq ORF 1332 bp
Locus ID 72399
Cytogenetics 5 F
Gene Summary Negatively regulates MAP kinase activation by limiting the formation of Raf/MEK complexes probably by inactivation of the KSR1 scaffold protein. Also acts as a Ras responsive E3 ubiquitin ligase that, on activation of Ras, is modified by auto-polyubiquitination resulting in the release of inhibition of Raf/MEK complex formation. May also act as a cytoplasmic retention protein with a role in regulating nuclear transport (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.