Cpvl (NM_001289714) Mouse Untagged Clone

CAT#: MC227680

Cpvl (untagged) - Mouse carboxypeptidase, vitellogenic-like (Cpvl), transcript variant 3


  "NM_001289714" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cpvl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cpvl
Synonyms 4933436L16Rik; HVLP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227680 representing NM_001289714
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTCGTGCCAAGTGGAAGATGGTTGTTTCACTGATCTTGTTTATGGTCAGCCCTGGTGATGGACTGT
TTCATGCAGTATACCGAAGTATCCTTGTTTCCCAGTCCTTCAAGGGGGATGCAGGACAGCCTCTTTTTCT
TAGCCCATACATCAAAAACGGGAAGATCAAGGAGGGGCAAAGGAAGAGCATGGTCAGTCCGTTCCCTGGA
ATGAACGACAAGAGTTATGCCGGCTACATCACGGTGAACCAGACTTACAACAGCAACCTCTTCTTCTGGT
TCTTTCCGGCTCGGATGCAGCCTGAGGATGCCCCAGTAGTCCTCTGGCTTCAGGGTGGACCTGGAGGTTC
ATCCATGTTTGGACTCTTTGTAGAACACGGGCCTTATATTATCACAAGTAACATGACCGTTGTGGCCAGA
GACTTCCCTTGGACCTTTACCCTTTCCATGCTCTACATTGATAATCCGGTGGGTACAGGCTTCAGCTTCA
CCGATCATTTCCAGGGATACGCCACCAGCGAGGATGATGTAGCCCAAGACTTGTACAGTGCCCTGATTCA
GTTCTTCACGTTGTTTCCCGAGTATGCAAAGAATGATTTTTACGTCACTGGCGAGTCTTATGCAGGGAAA
TATGTTCCGGCCCTAGCACACTATATCCACTCCCTCAACCCCGTGCGGAAGTTCAAGATTCGCCTAAAAG
GAATTGCCATTGGAGATGCATACACTGATCCTGAATCGATCCTGGATAAGCTGCTAGATGGAGATGTAAC
AACTGGTTCATCTTTCTTCCAGAATGTGACAGGATGTACCAATTACTACAACATTTTACAGTGCACGGAA
CCCAAGGAGCAAAGTTACTTTGCAAAATTCTTGACGCTCCCCCAAGTGAGACAAGCCATCCACGTGGGAA
ACCAGAACTTCAGTGACGGTGCTGAGGTTGAGAAGCACCTGCGAGAGGACACAGTGAAGTCGGTGAAGCC
CTGGCTGTCTGAGATCATGAATTACTACAAGGTTCTCATCTACAATGGCCAACTGGACATCATCGTGGCG
GCTGCCCTGACAGAGCGCTCCTTGATGGCCATGGACTGGAAGGGATCCCGAGCATACAGAAGGGCACGTC
GAAAGGTCTGGAAGATCTTCAAATCGGATAATGAAGTGGCTGGTTATGTGAGGCGTGTGGGCAAATTCCA
TCAGGTAATCGTCCGAGGTGGAGGACACATTTTGCCCTATGACCAGCCAATGAGATCTTTTGATATGATC
AATCGCTTCATCTATGACAGAGGATGGGAACCTTATAATTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289714
Insert Size 1305 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289714.1, NP_001276643.1
RefSeq Size 1490 bp
RefSeq ORF 1305 bp
Locus ID 71287
UniProt ID Q9D3S9
Cytogenetics 6 B3
Gene Summary This gene encodes a member of the serine carboxypeptidase family of proteases that cleave amino acids from the C-terminus of a protein substrate. The human ortholog of this gene, where it was first characterized, was found to be upregulated during the maturation of monocytes to macrophages. The encoded protein may be involved in antigen processing, digestion of phagocytosed proteins in the lysosome and lamellipodium formation. Disruption of this gene in mice was found to cause embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.