Dennd6a (NM_001285466) Mouse Untagged Clone

CAT#: MC227405

Dennd6a (untagged) - Mouse DENN/MADD domain containing 6A (Dennd6a), transcript variant 3


  "NM_001285466" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dennd6a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dennd6a
Synonyms Fam116a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227405 representing NM_001285466
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACTAGTAATGAAGGTTCGGATTCCCACGTGTCATGACAAGCCTGGGACCACGCAGATGGTGCAGT
TAACTCAGCAGGCAGATACACACACATCTATTATTTTGCCTACTGTTCACGAGGTGGATCTTTTCAGGTG
TTTCTGCCCAGTTTTTCTTCACAGTCAGATGCTCTGGGAGTTGGTGCTCTTGGGAGAGCCCCTGGTGGTC
ATGGCGCCATCGCCGTCAGAATCTTCAGAAACTGTACTGGCTCTTGTTAACTGTATCTCTCCATTAAAGT
ACTTTAGTGATTTTCGGCCTTACTTCACGATTCATGATAGTGAATTCAAAGAATATACTACCCGTACTCA
AGCTCCGCCCTCAGTCATCTTAGGAGTAACCAACCCCTTTTTTGCTAAAACACTACAGCACTGGCCACAC
ATTATTCGAATAGGAGATCTTAAACCTGCAGGTGAAATTCCTAAGCAAGTTAAAGTGAAAAAGCTGAAGA
ACCTAAAAACTCTGGATTCTAAACCTGGAGTTTATACTTCTTACAAGCCATATCTAAACAGAGATGAGGA
GATCATAAAACAACTTCAGAAGGGTATACAGCAGAAGCGTCCTTCTGAGGCCCAAAGTGTTATTCTCCGG
CGCTATTTTTTGGAACTAACACAAAGTTTCATCATTCCATTAGAAAGATATGTGGCAAGCTTGATGCCTT
TGCAGAAAAGTATTTCTCCTTGGAAGAGTCCACCCCAGTTACGGCAGTTCCTTCCAGAAGAATTTATGAA
AACACTTGAAAAAACAGGGCCTCAGCTCACCTCTGGAATAAAGGGCGACTGGATTGGACTTTACCGGCAG
TTTCTAAAGTCTCCAAATTTTGATGGCTGGTTCAAGACCCGGCGGAAAGAAATGACTCAAAAATTGGAGG
CACTTCATCTAGAAGCTCTTTGTGAAGAGGACCTCCTTCTCTGGATCCAGAAACACACAGAAGTAGAAAC
AGTGGACCTTGTGTTGAAGCTGAAAAATAAGTTGTTGCAGGCTGGCCGAGAGAGCTTACCTGTGAAGCCT
GACACTGTGGAGAAGTTACGGACACATATAGATGCAATTATCCTGGCCTTACCAGACGACCTGCAAGGCA
TACTGCTCAAGACCGGCATGACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285466
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285466.1, NP_001272395.1
RefSeq Size 6512 bp
RefSeq ORF 1146 bp
Locus ID 211922
UniProt ID Q8BH65
Cytogenetics 14 A3
Gene Summary Guanine nucleotide exchange factor (GEF) for RAB14. Component of an endocytic recycling pathway that is required for the control of ADAM10 transport, shedding of N-cadherin/CDH2 by ADAM9 or ADAM10 and regulation of cell-cell junctions. Required for RAB14 recruitment to recycling endosomes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks several exons, uses an alternate 5'-terminal exon, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus, compared to isoform a. Both variants 3 and 4 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.