Ada (NM_001272052) Mouse Untagged Clone

CAT#: MC227224

Ada (untagged) - Mouse adenosine deaminase (Ada), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ada
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227224 representing NM_001272052
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCAGACACCCGCATTCAACAAACCCAAAGTAGAGTTACACGTCCACCTGGATGGAGCCATCAAGC
  CAGAAACCATCTTATACTTTGGCAAGAAGAGAGGCATCGCCCTCCCGGCAGATACAGTGGAGGAGCTGCG
  CAACATTATCGGCATGGACAAGCCCCTCTCGCTCCCAGGCTTCCTGGCCAAGTTTGACTACTACATGCCT
  GTGATTGCGGGCTGCAGAGAGGCCATCAAGAGGATCGCCTACGAGTTTGTGGAGATGAAGGCAAAGGAGG
  GCGTGGTCTATGTGGAAGTGCGCTATAGCCCACACCTGCTGGCCAATTCCAAGGTGGACCCAATGCCCTG
  GAACCAGACTGAAGGGGACGTCACCCCTGATGACGTTGTGGATCTTGTGAACCAGGGCCTGCAGGAGGGA
  GAGCAAGCATTTGGCATCAAGGTCCGGTCCATTCTGTGCTGCATGCGCCACCAGCCCAGCTGGTCCCTTG
  AGGTGTTGGAGCTGTGTAAGAAGTACAATCAGAAGACCGTGGTGGCTATGGACTTGGCTGGGGATGAGAC
  CATTGAAGGAAGTAGCCTCTTCCCAGGCCACGTGGAAGCCTATGAGGGCGCAGTAAAGAATGGCATTCAT
  CGGACCGTCCACGCTGGCGAGGTGGGCTCTCCTGAGGTTGTGCGTGAGGCTGTGGACATCCTCAAGACAG
  AGAGGGTGGGACATGGTTATCACACCATCGAGGATGAAGCTCTCTACAACAGACTACTGAAAGAAAACAT
  GCACTTTGAGGTCTGCCCCTGGTCCAGCTACCTCACAGGCGCCTGGGATCCCAAAACGACGCATGCGGTT
  GTTCGCTTCAAGAATGATAAGGCCAACTACTCACTCAACACAGACGACCCCCTCATCTTCAAGTCCACCC
  TAGACACTGACTACCAGATGACCAAGAAAGACATGGGCTTCACTGAGGAGGAGTTCAAGCGACTGAACAT
  CAACGCAGCGAAGTCAAGCTTCCTCCCAGAGGAAGAGAAGAAGGAACTTCTGGAACGGCTCTACAGAGAA
  TACCAATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272052
• Insert Size: 1059 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001272052.1, NP_001258981.1
• RefSeq Size: 1704 bp
• RefSeq ORF: 1059 bp
• Locus ID: 11486
• UniProt ID: P03958
• Cytogenetics: 2 H3
• Gene Summary: Catalyzes the hydrolytic deamination of adenosine and 2-deoxyadenosine (PubMed:9272950). Plays an important role in purine metabolism and in adenosine homeostasis (PubMed:9272950, PubMed:10720488). Modulates signaling by extracellular adenosine, and so contributes indirectly to cellular signaling events (PubMed:11435465). Acts as a positive regulator of T-cell coactivation, by binding DPP4. Its interaction with DPP4 regulates lymphocyte-epithelial cell adhesion (By similarity). Enhances dendritic cell immunogenicity by affecting dendritic cell costimulatory molecule expression and cytokines and chemokines secretion (By similarity). Enhances CD4+ T-cell differentiation and proliferation (By similarity). Acts as a positive modulator of adenosine receptors ADORA1 and ADORA2A, by enhancing their ligand affinity via conformational change (By similarity). Stimulates plasminogen activation (By similarity). Plays a role in male fertility (By similarity). Plays a protective role in early postimplantation embryonic development (PubMed:9272950).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.