Retreg1 (NM_001277317) Mouse Untagged Clone

CAT#: MC227184

Fam134b (untagged) - Mouse family with sequence similarity 134, member B (Fam134b), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Retreg1
• Synonyms: 1810015C04Rik; AU015349; Fam134b; Retreg1d
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227184 representing NM_001277317
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCTGGGAAGTCATCAATTCCAAGCCAGATGAAAGAGCCAGACTGAGCCAGTGCATTGCAGAATCAT
  GGATGAATTTCAGCATGTTTCTTCAAGAAATGTCTCTTTTTAAACAGCAGAGTCCTGGCAAGTTTTGCCT
  CCTGGTCTGCAGTGTGTGCACATTTTTTACAATCTTGGGAAGTTACATTCCTGGGGTCATACTCAGCTAC
  CTTCTGTTACTGTTTGCTTTTTTGTGTCCACTGTTTAAATGTAATGATATTGGACAAAAAATATACAGCA
  AAGTCAAGTCCATTCTATTAAAACTAGATTTTGGAATTGGAGAATATATTAACCAGAAGAAACGTGAGAG
  ATCTGAAGCAGATAAAGAAAAAAGTCACAAGGATGACAGTGAATTAGACTTTTCAGCTCTTTGTCCTAAG
  ATTAGCCTCACAGTTGCTGCCAAAGAGTTATCTGTGTCAGACACAGATGTGTCAGAAGTCTCTTGGACTG
  ACAATGGGACCTTCAACCTTTCAGAGGGGTACACTCCGCAGACAGACACTTCTGACGATCTTGACCGGCC
  CAGTGAGGAAGTTTTCTCTCGAGATCTTTCAGATTTTCCATCTCTGGAAAATGGGACGGGAACAAATGAT
  GAAGATGAATTAAGCCTGGGCTTACCCACAGAGCTCAAGAGAAAGAAGCAGCAGTTGGATAGTGCTCACA
  GACCAAGCAAAGAACGGCAGTCGGCAGCTGGCCTCTCACTTCCTCTCAAGAGCGACCAAGCCCTTCACTT
  GATGAGCAACCTGGCTGGGGATGTCATCACAGCCGCCATGACGGCTGCCATCAAAGACCAGCTAGAAGGA
  GCCCGGCAGGCACTCACTCAGGTGGCGCCCACTGCGGGAGAGGACACAGACACTGAGGAGGGGGATGACT
  TTGAACTACTTGACCAGGCAGAGCTAGATCAAATTGAGAGTGAGCTGGGACTAACACAAGACCAAGGGGC
  AGAAGCCCAGCAAAGTAAGAAATCCTCAGGCTTCCTCTCCAATCTGCTTGGAGGCCATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277317
• Insert Size: 1041 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277317.1, NP_001264246.1
• RefSeq Size: 2789 bp
• RefSeq ORF: 1041 bp
• Locus ID: 66270
• UniProt ID: Q8VE91
• Cytogenetics: 15 B1
• Gene Summary: Endoplasmic reticulum-anchored autophagy receptor that mediates ER delivery into lysosomes through sequestration into autophagosomes (PubMed:26040720). Promotes membrane remodeling and ER scission via its membrane bending capacity and targets the fragments into autophagosomes via interaction with ATG8 family proteins (PubMed:26040720). Required for long-term survival of nociceptive and autonomic ganglion neurons (PubMed:19838196, PubMed:26040720).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) differs in the 5' UTR and 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct and shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.