Gfra2 (NM_001302095) Mouse Untagged Clone

CAT#: MC227079

Gfra2 (untagged) - Mouse glial cell line derived neurotrophic factor family receptor alpha 2 (Gfra2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gfra2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227079 representing NM_001302095
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCTTGGCAAACGCCTTCTGCCTCTTCTTCTTTTTAGGGACAGGGGCAGACCCGGTGGTCAGTGCCA
  AGAGCAACCACTGCCTGGATGCCGCCAAGGCCTGCAACCTGAACGACAACTGCAAGAAGCTCCGCTCCTC
  CTACATCTCCATCTGCAACCGCGAGATCTCTCCCACCGAACGCTGCAACCGCCGCAAGTGCCACAAGGCC
  CTGCGCCAGTTCTTCGACCGTGTGCCCAGCGAGTATACCTACCGCATGCTCTTCTGCTCCTGTCAGGACC
  AGGCATGCGCCGAGCGTCGCCGGCAAACCATCCTGCCCAGCTGTTCCTATGAGGACAAAGAGAAGCCCAA
  TTGCTTGGACCTGCGCAGCCTGTGTCGTACAGACCACTTGTGCCGGTCCCGCCTGGCAGACTTCCACGCC
  AACTGTCGAGCCTCCTACCGGACAATCACCAGCTGCCCTGCGGACAACTACCAGGCATGTCTGGGCTCCT
  ATGCTGGCATGATTGGGTTTGATATGACACCGAACTATGTGGACTCCAACCCCACGGGCATCGTGGTGTC
  TCCCTGGTGCAATTGTCGTGGCAGTGGGAACATGGAAGAAGAGTGTGAGAAGTTCCTCAAGGACTTCACA
  GAAAACCCATGCCTCCGGAATGCCATTCAAGCCTTTGGCAATGGCACAGATGTGAACATGTCTCCCAAAG
  GCCCCACATTTTCAGCTACCCAGGCCCCTCGGGTAGAGAAAACTCCTTCACTGCCAGATGACCTCAGTGA
  TAGCACCAGCCTGGGGACCAGTGTCATCACCACCTGCACATCTATCCAGGAGCAAGGGCTGAAGGCCAAC
  AACTCCAAAGAGTTAAGCATGTGTTTCACAGAGCTCACGACAAATATCAGCCCAGGGAGTAAAAAGGTGA
  TCAAACTTTACTCAGGCTCCTGCAGAGCCAGACTGTCGACTGCCTTGACTGCCCTCCCACTCCTGATGGT
  GACCTTGGCCCAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302095
• Insert Size: 996 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302095.1, NP_001289024.1
• RefSeq Size: 3088 bp
• RefSeq ORF: 996 bp
• Locus ID: 14586
• UniProt ID: O08842
• Cytogenetics: 14 D2
• Gene Summary: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (3) lacks two consecutive in-frame exons in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 3) compared to isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1.