Fst (NM_001301375) Mouse Untagged Clone

CAT#: MC226998

Fst (untagged) - Mouse follistatin (Fst), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fst
• Synonyms: AL033346; D2Mgi5; FS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226998 representing NM_001301375
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTCTGCGCCAGGCACCAGCCCGGCGGGCTCTGCCTCCTGCTGCTGCTACTCTGCCAGTTCATGGAGG
  ACCGCAGCGCCCAGGCTGGGAATTGCTGGCTCCGCCAAGCAAAGAACGGCCGCTGCCAGGTCCTGTATAA
  GACAGAACTGAGCAAGGAAGAGTGTTGCAGCACCGGCCGGCTGAGCACCTCATGGACCGAGGAGGATGTG
  AACGACAATACTCTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCTTGTAAAGAAA
  CGTGTGAGAACGTGGACTGCGGACCTGGGAAAAAATGTCGAATGAACAAGAAGAATAAACCCCGCTGCGT
  CTGTGCCCCAGACTGTTCCAACATCACCTGGAAGGGCCCAGTGTGTGGGCTGGATGGGAAAACCTACCGC
  AACGAATGTGCACTCCTCAAGGCCAGATGCAAAGAGCAGCCGGAACTAGAAGTACAGTACCAGGGCAAAT
  GTAAAAAGACTTGTAGGGATGTTTTTTGTCCAGGCAGCTCCACTTGTGTGGTGGATCAGACCAATAATGC
  CTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCCTCCTCTTCTGAACAGTACCTTTGTGGAAATGAT
  GGAGTGACTTACTCCAGCGCCTGCCACCTGAGAAAGGCCACCTGCTTGCTGGGCAGATCCATTGGATTAG
  CCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGTGGCGGCGGGAAAAAATGCCT
  ATGGGATTCCAAGGTTGGCAGAGGTCGCTGCTCTCTCTGCGATGAGCTGTGTCCTGACAGTAAGTCGGAT
  GAGCCGGTCTGTGCCAGTGACAATGCCACATACGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCTT
  CTGGCGTGCTTCTTGAAGTGAAGCATTCTGGATCTTGCAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301375
• Insert Size: 954 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301375.1, NP_001288304.1
• RefSeq Size: 2875 bp
• RefSeq ORF: 954 bp
• Locus ID: 14313
• UniProt ID: P47931
• Cytogenetics: 13 D2.2
• Gene Summary: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes FST288 (PMID:20032047), which has a shorter C-terminus, compared to FST315.