Rp2 (NM_001290644) Mouse Untagged Clone

CAT#: MC226947

Rp2h (untagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rp2
• Synonyms: AI662636; Rp2h
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226947 representing NM_001290644
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTAGTGGACTGAAGGATGAAACAGTAGGTCGCTTACCTGGAAAAGTGGCAGGACAACAATTTGTCA
  TTCAAGACTGTGAGAACTGTAACATCTATATTTTTGACCACTCAGCTACTATTACCATTGATGACTGCAC
  TAACTGTGTAATTTTTTTGGGACCAGTGAAAGGCAGTGTCTTTTTCCGAAATTGTAGAGATTGCAAGTGC
  ACATTGGCTTGCCAGCAATTTCGTGTGAGAGACTGTAGAAAGTTGGAAGTCTTTTTGTGCTGTGCTACTC
  AACCCATTATTGAATCTTCCACAAACATCAAGTTTGGCTGTTTTCAATGGTACTACCCTGAATTAGCAGC
  CCAATTCAAAGATGCAGGCCTCAGTATCTTCAATAACATTTGGAGTCATGTTCATGATTTTACACCTGTG
  TCAGGAGAGCTCAACTGGAGCCTTCTTCCAGAAAATGCCGTGGTTCAAGACTATGTTCCTATCCCAATGA
  CTGAAGAATTCAAAGCTGTGCGAATTTCCACAGAAGCCAATAGAAGCATTGTTCCTGTGTCCCGGGGTCA
  GAGACAGAAGTACAGTGATGAATCATGTCTTGTGGTATTATTTGCCGATGATTATACAACTGCAAATGCC
  AGGAAACTAATTGATGAGATGGTTGGTAAAGGCTTCTCCCTAGTGCAGACAAAGGAAATGTCAATGAAAA
  CTGAAGACGCCCAAAGGGTTTTCCAGGAAAAGGCATCAGATTTTTTACTTCTTCTAAACAAAGGTCCTGT
  GATTGCCTTGGAATTTAATGGAGATGACGCTGTACAAGAATGTCACCTTATTGTAAATGGGATGTTCAAC
  GGGACAAAGATGTTTGTATCAGAAAAGAAGGAGACCGCATCTGGAGATGTTGATAGCTTCTATAACTTTG
  CTGAGATCCAGATGGGGATATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290644
• Insert Size: 933 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290644.1, NP_001277573.1
• RefSeq Size: 4581 bp
• RefSeq ORF: 933 bp
• Locus ID: 19889
• UniProt ID: Q9EPK2
• Cytogenetics: X A1.3
• Gene Summary: Acts as a GTPase-activating protein (GAP) involved in trafficking between the Golgi and the ciliary membrane. Involved in localization of proteins, such as NPHP3, to the cilium membrane by inducing hydrolysis of GTP ARL3, leading to the release of UNC119 (or UNC119B). Acts as a GTPase-activating protein (GAP) for tubulin in concert with tubulin-specific chaperone C, but does not enhance tubulin heterodimerization. Acts as guanine nucleotide dissociation inhibitor towards ADP-ribosylation factor-like proteins.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an alternate exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.