Ccnd3 (NM_001081635) Mouse Untagged Clone

CAT#: MC226837

Ccnd3 (untagged) - Mouse cyclin D3 (Ccnd3), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ccnd3
• Synonyms: 9230106B05Rik; AA682053; AL024085; AW146355; C78795
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226837 representing NM_001081635
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCTGCTGTGTTGCGAGGGCACCCGGCACGCGCCCCGGGCCGGGCCCGACCCGCGGCTGCTTGGGG
  ACCAGCGTGTCCTGCAGAGTTTACTCCGCCTGGAGGAGCGCTACGTGCCGCGAGCCTCCTACTTCCAGTG
  CGTGCAAAAGGAGATCAAGCCGCACATGCGGAAGATGCTGGCATACTGGATGCTGGAGGTGTGTGAGGAG
  CAGCGCTGCGAGGAGGATGTCTTCCCTCTGGCTATGAACTACCTGGATCGCTACCTGTCCTGCGTCCCCA
  CCCGAAAGGCGCAATTGCAGCTTCTAGGTACCGTCTGCCTGTTGCTGGCCTCCAAGCTGCGCGAAACCAC
  GCCCCTGACTATTGAGAAGCTTTGCATCTATACGGACCAGGCTGTGGCTCCATGGCAGTTGCGGGAGTGG
  GAGGTGCTGGTCCTGGGGAAGCTCAAGTGGGACCTGGCTGCCGTGATTGCGCACGACTTCCTGGCCTTGA
  TTCTGCACCGCCTGTCTCTGCCCAGTGACCGGCAGGCTTTGGTCAAAAAGCATGCCCAGACCTTTTTGGC
  CCTCTGTGCTACAGATTACACCTTTGCGATGTATCCTCCATCCATGATCGCCACAGGCAGCATTGGGGCA
  GCCGTGCTAGGCCTAGGCGCCTGCTCTATGTCTGCGGATGAGCTCACAGAGTTGCTGGCCGGGATCACAG
  GCACTGAAGTGGACTGCCTGCGAGCCTGCCAGGAACAGATCGAAGCTGCCCTCAGGGAGAGCCTCAGGGA
  AGCTGCTCAGACAGCCCCCAGCCCAGTGCCCAAAGCCCCCCGGGGCTCTAGCAGCCAGGGGCCCAGTCAG
  ACCAGCACTCCCACAGATGTCACAGCCATTCACCTGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001081635
• Insert Size: 879 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001081635.1, NP_001075104.1
• RefSeq Size: 2086 bp
• RefSeq ORF: 879 bp
• Locus ID: 12445
• UniProt ID: P30282
• Cytogenetics: 17 23.37 cM
• Gene Summary: Regulatory component of the cyclin D3-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also substrate for SMAD3, phosphorylating SMAD3 in a cell-cycle-dependent manner and repressing its transcriptional activity. Component of the ternary complex, cyclin D3/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an alternate splice site in the 5' UTR, compared to variant 3. Variant 2 encodes the same protein as variant 3.