Tpm2 (NM_001277876) Mouse Untagged Clone

CAT#: MC226789

Tpm2 (untagged) - Mouse tropomyosin 2, beta (Tpm2), transcript variant Tpm2.1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tpm2
• Synonyms: Tpm-; Tpm-2; Tro; Trop-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226789 representing NM_001277876
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAACTGGACAAGGAGAATGCCATCGACCGCGCGGAGC
  AGGCCGAAGCCGACAAAAAGCAAGCTGAAGACCGATGCAAGCAGCTGGAGGAAGAGCAGCAGGCCCTCCA
  GAAGAAGCTGAAGGGGACAGAGGACGAGGTGGAAAAGTATTCCGAGTCCGTGAAGGATGCCCAGGAGAAA
  CTGGAGCAGGCTGAGAAGAAGGCCACCGACGCTGAAGCAGATGTGGCCTCTCTGAACCGCCGCATTCAGC
  TCGTAGAGGAGGAGTTGGATCGGGCACAGGAGCGCCTGGCTACAGCCTTGCAAAAGCTGGAGGAGGCTGA
  GAAAGCCGCGGATGAGAGCGAGAGAGGAATGAAGGTCATTGAAAACCGGGCCATGAAGGATGAGGAAAAG
  ATGGAGCTGCAGGAGATGCAGCTGAAGGAAGCCAAGCACATCGCTGAGGACTCAGACCGCAAATATGAGG
  AGGTGGCCAGGAAGCTGGTGATCCTGGAAGGGGAGCTGGAGCGCTCGGAAGAGAGAGCCGAGGTGGCTGA
  GAGCCGAGCCAGACAGCTGGAGGAGGAGCTTCGAACCATGGACCAAGCCCTCAAGTCGCTGATAGCCTCA
  GAGGAGGAGTATTCCACCAAAGAGGACAAATACGAAGAAGAGATCAAACTTCTGGAGGAGAAGCTGAAAG
  AGGCTGAGACCCGAGCAGAGTTTGCTGAAAGATCTGTGGCAAAGTTGGAGAAAACCATTGATGATCTGGA
  AGAGACTTTGGCCAGTGCCAAGGAAGAGAACGTGGAGATACACCAGACCTTGGACCAGACCCTTCTGGAA
  CTCAACAACCTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277876
• Insert Size: 855 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277876.1, NP_001264805.1
• RefSeq Size: 2108 bp
• RefSeq ORF: 855 bp
• Locus ID: 22004
• Cytogenetics: 4 A5
• Gene Summary: This gene belongs to the tropomyosin family which encodes proteins that bind to actin filaments and stabilize them by regulating access to actin modifying proteins. The encoded protein is a high molecular weight tropomyosin expressed in slow skeletal muscle. In humans, mutations in this gene are associated with nemaline myopathy, cap disease and distal arthrogryposis syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
  Transcript Variant: This variant (Tpm2.1, also known as variant 3) differs in the 3' UTR and has multiple differences in the 3' coding region, compared to variant Tpm2.2. It encodes isoform Tpm2.1sm/cy (also known as isoform 3), which is of the same size but has a different internal segment and a distinct C-terminus, compared to isoform Tpm2.2st.