Tomt (NM_001282088) Mouse Untagged Clone

CAT#: MC226624

Tomt (untagged) - Mouse transmembrane O-methyltransferase (Tomt), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tomt
• Synonyms: Comt2; F930017I19Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226624 representing NM_001282088
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCCCTGCCATTGCACTGGCATTCCTGCCACTCGTGGTAACACTGCTGGTGAGATACCGGCACCATT
  TCCGACTGCTGGTGCGTACAGTCCTGCTGAGAGGATTTCGAGACTGCCTGTCAGGACTTCGGATTGAGGA
  GCGGGCTTTCAGCTATGTGCTCACCCATGCCCTGCCTGGAGACCCTGGTCACATCCTCACCACGCTTGAC
  CATTGGAGCAGCTGCTGCGAGTACCTGAGCCACATGGGCCCTGTTAAAGGTCAGATTCTGATGCGGCTGG
  TGGAAGAGAAGGCCCCTGCTTGTGTGCTGGAGCTGGGCACATACTGTGGATACTCTACACTGCTTATTGC
  GCGAGCCTTGCCCCCTGGAAGTCGCCTTCTCACTGTGGAGCGGGACTCACGTACAGCAGCAGTGGCTGAA
  AAAGTCATCCGGCTGGCAGGCTTCGATGAGCAAATGGTGGAGCTCATTGCAGGCAGCTCAGAGGAAGTGA
  TCCCACGCCTAAGAGCTCAGCACCAGCTGAATCGTGCAGATCTGGTGCTCCTGGCACACCGACCTCGGTA
  TTACTTAAGGGATCTGCAGCTACTGGAGGCCCATGCTCTGCTCCCACATGGCGCCACTGTATTGGCTGAC
  CATGTGCTTTTTCCTGGTGCACCCCGCTTCCTACAGTACACCAAGAGCTGTGGTCGCTATCGCTGCCGCC
  TTCACCACACCAGCCTCCCAGACTTCCCTGCCATTAAAGATGGCATAGCCCAACTCACCTATACTGGACC
  CGGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282088
• Insert Size: 777 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282088.1, NP_001269017.1
• RefSeq Size: 1358 bp
• RefSeq ORF: 777 bp
• Locus ID: 791260
• UniProt ID: A1Y9I9
• Cytogenetics: 7
• Gene Summary: Catalyzes the O-methylation, and thereby the inactivation, of catecholamine neurotransmitters and catechol hormones (PubMed:18794526). Required for auditory function (PubMed:18794526, PubMed:28504928). Component of the cochlear hair cell's mechanotransduction (MET) machinery. Involved in the assembly of the asymmetric tip-link MET complex. Required for transportation of TMC1 and TMC2 proteins into the mechanically sensitive stereocilia of the hair cells. The function in MET is independent of the enzymatic activity (PubMed:28504928).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an alternate 5' UTR exon, compared to variant 1. Both variants 1 and 2 encode the same protein.