Folr1 (NM_001252553) Mouse Untagged Clone

CAT#: MC226610

Folr1 (untagged) - Mouse folate receptor 1 (adult) (Folr1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Folr1
• Synonyms: FBP1; Folbp-1; Folbp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226610 representing NM_001252553
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTCACCTGATGACTGTGCAGTTGTTGCTCCTGGTGATGTGGATGGCCGAATGTGCTCAGTCCAGAG
  CTACTCGGGCCAGGACTGAACTTCTCAATGTCTGCATGGATGCCAAACACCACAAAGAAAAACCGGGCCC
  TGAGGACAATTTACACGACCAGTGCAGCCCCTGGAAGACGAATTCCTGCTGTTCCACGAACACAAGCCAG
  GAAGCACATAAGGACATTTCCTACCTGTACCGGTTCAACTGGAACCACTGCGGAACTATGACATCGGAAT
  GCAAACGGCACTTTATCCAAGACACCTGCCTCTATGAGTGTTCCCCGAACTTGGGACCCTGGATCCAGCA
  GGTGGACCAGAGCTGGCGCAAAGAGCGGATCCTTGATGTTCCCCTGTGCAAAGAGGACTGTCAGCAGTGG
  TGGGAGGACTGCCAGAGCTCTTTTACCTGCAAGAGCAATTGGCACAAGGGATGGAACTGGTCCTCGGGGC
  ATAACGAGTGTCCTGTGGGAGCCTCCTGCCATCCCTTCACCTTCTACTTCCCCACATCTGCTGCTCTGTG
  TGAGGAAATCTGGAGTCACTCCTACAAGCTCAGCAACTACAGTCGAGGGAGCGGCCGCTGCATTCAGATG
  TGGTTCGACCCAGCCCAGGGCAACCCCAACGAGGAAGTGGCGAGGTTCTATGCCGAGGCCATGAGTGGAG
  CTGGGTTTCATGGGACCTGGCCACTCTTGTGCAGCCTGTCCTTAGTGCTGCTCTGGGTGATCAGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252553
• Insert Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252553.1, NP_001239482.1
• RefSeq Size: 1337 bp
• RefSeq ORF: 768 bp
• Locus ID: 14275
• UniProt ID: P35846
• Cytogenetics: 7 E2
• Gene Summary: Binds to folate and reduced folic acid derivatives and mediates delivery of 5-methyltetrahydrofolate and folate analogs into the interior of cells. Has high affinity for folate and folic acid analogs at neutral pH. Exposure to slightly acidic pH after receptor endocytosis triggers a conformation change that strongly reduces its affinity for folates and mediates their release. Required for normal embryonic development and normal cell proliferation. Required for renal folate reabsorption.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses two different splice sites in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 all encode the same protein.