Cyb561a3 (NM_001282067) Mouse Untagged Clone

CAT#: MC226519

Cyb561a3 (untagged) - Mouse cytochrome b561 family, member A3 (Cyb561a3), transcript variant 4


  "NM_001282067" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cyb561a3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cyb561a3
Synonyms 2310004G04Rik; Cybasc3; Lcytb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226519 representing NM_001282067
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCAGGATGGTTTTACCTGTCCTGCATGGTGCTGGGATCGCTGGGATCGATGTGCATCCTCTTCA
CTGCCTACTGGATGCAGTACTGGCGCGGTGGCTTTGCCTGGGATGGCACGGTGCTCATGTTTAACTGGCA
CCCAGTGCTCATGGTTGCCGGCATGGTGGTGCTCTATGGAGCTGCCTCACTGGTGTACCGCCTGCCTTCA
TCGTGGGTGGGGCCCAGGCTGCCCTGGAAAGTTCTCCATGCAGCACTGCACCTGCTGGCCTTCACCTGCA
CTGTGGTGGGGCTGATTGCCGTCTTTCGGTTTCACAACCACTCGAGAATCGCACACCTCTACTCCCTGCA
CAGCTGGCTGGGTATCACCACTGTAGTCCTCTTCGCCTGCCAGTGGTTCCTGGGCTTTGCTGTCTTCCTC
CTGCCCTGGGCATCCCAGTGGCTGCGAAGCCTCCTGAAACCTCTGCATGTATTCTTTGGAGCCTGCATCC
TTTCCCTGTCCATCACATCTGTTATTTCCGGCATCAATGAGAAGCTTTTCTTTGTTTTGAAAAATGCCAC
CAAGCCCTACTCCAGCCTGCCTGGTGAGGCTGTCTTTGCCAACAGCACAGGGCTCTTGGTGGTGGCTTTT
GGCTTGCTGGTTCTCTATGTTCTTCTGGCTTCATCATGGAAGCGTCCAGATCCAGGAGCTCTGACTGATA
GACAGCCCCTGTTGCATGACAGGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282067
Insert Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282067.1, NP_001268996.1
RefSeq Size 3187 bp
RefSeq ORF 729 bp
Locus ID 225912
UniProt ID Q6P1H1
Cytogenetics 19 A
Gene Summary Ferric-chelate reductase that reduces Fe(3+) to Fe(2+) before its transport from the endosome to the cytoplasm. Probably uses ascorbate as electron donor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 4 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.