Snrpn (NM_013670) Mouse Untagged Clone

CAT#: MC226510

Snrpn (untagged) - Mouse small nuclear ribonucleoprotein N (Snrpn), transcript variant 1


  "NM_013670" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Snrpn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snrpn
Synonyms 2410045I01Rik; HCERN3; Peg; Peg4; Pwc; sm-D; SMN; snRNP-N
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226510 representing NM_013670
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGTGGGTAAGAGTAGCAAGATGCTGCAGCACATTGACTATAGGATGAGATGTATCCTGCAAGATG
GGAGAATCTTCATTGGCACCTTCAAGGCTTTTGACAAGCATATGAATTTGATCCTCTGTGATTGTGATGA
GTTCAGGAAGATCAAGCCAAAGAATGCAAAACAGCCAGAACGTGAAGAAAAACGGGTTTTGGGTCTGGTC
TTGCTACGTGGGGAGAACTTGGTTTCAATGACTGTGGAGGGCCCACCTCCTAAAGATACTGGCATTGCTC
GTGTGCCTCTTGCTGGCGCTGCAGGTGGCCCTGGGGTTGGAAGAGCAGCTGGCAGAGGAGTGCCAGCAGG
TGTACCTATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCAGAGGAGTTGGAGGCCCATCCCAGCAG
GTCATGACCCCACAGGGAAGAGGCACTGTTGCAGCTGCTGCTGTTGCTGCTACTGCTAGCATTGCAGGAG
CCCCAACCCAGTACCCGCCAGGACGGGGAACTCCACCTCCACCTGTAGGCAGAGCAACCCCACCTCCAGG
CATTATGGCTCCTCCACCTGGTATGAGACCACCCATGGGCCCACCCATTGGGCTTCCCCCTGCTCGTGGG
ACACCTATAGGCATGCCTCCTCCAGGAATGAGACCCCCTCCACCAGGAATTAGAGGCCCACCTCCCCCAG
GAATGCGCCCACCAAGACCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013670
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013670.3, NP_038698.1
RefSeq Size 1970 bp
RefSeq ORF 723 bp
Locus ID 20646
UniProt ID P63163
Cytogenetics 7 34.04 cM
Gene Summary This locus represents a paternally-expressed imprinted gene that encodes a component of the small nuclear ribonucleoprotein complex, which functions in pre-mRNA processing. Genomic and genetic changes in this region result in growth defects and lethality; the corresponding region in human is the critical region for Prader-Willi Syndrome. Alternative promoter use and alternative splicing result in a multitude of transcript variants encoding the same protein. Transcript variants may be bicistronic and also encode the SNRPN upstream reading frame protein (Snurf) from an upstream open reading frame. In addition, long spliced transcripts for small nucleolar RNA host gene 14 (Snhg14) may originate from the promoters at this locus and incorporate exons shared with this gene. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (1) represents the predominant variant. This splice variant is bicistronic and can also encode the Snurf protein from an upstream open reading frame.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.