Lair1 (NM_001302675) Mouse Untagged Clone
CAT#: MC226395
Lair1 (untagged) - Mouse leukocyte-associated Ig-like receptor 1 (Lair1), transcript variant e
"NM_001302675" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Lair1 |
Synonyms | 5133400O11Rik; BB115266; D7Bwg0421e; Lair-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226395 representing NM_001302675
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACTTCATCCAGTTATCCTGCTGGTGCTTGTGCTGTGCCTGGGATGGAAAATTAACACACAGGAGG GTTCTCTGCCTGATATTACCATCTTCCCTAATTCAAGTCTTATGATCTCCCAAGGGACTTTTGTAACTGT TGTGTGCTCATACTCTGATAAACACGACTTGTATAACATGGTCCGCCTGGAGAAGGACGGCAGCACCTTT ATGGAAAAGAGCACTGAGCCTTATAAAACAGAGGATGAATTTGAGATTGGGCCAGTGAATGAAACCATTA CTGGACATTATAGCTGTATCTATTCGAAGGGGATTACCTGGTCCGAACGTAGTAAGACGCTGGAGCTAAA GGTGATCAAAGAAAATGTCATCCAGACTCCTGCCCCAGGTCCAACCTCAGGACTCCCAAACAACAAAAGA CAGCAGCAGAGGCCAGAAGAGAGGCTAAATCTAGCTACTAATGGCCTGGAGATGACTCCAGACATAGTTG CAGATGACAGGCTTCCTGAGGACAGATGGACAGAAACCTGGACCCCAGTTGCAGGAGACCTTCAAGAGGT GACGTATATCCAGCTGGACCATCACTCCCTCACACAGAGGGCAGTCGGAGCTGTGACCTCACAGAGCACA GATATGGCTGAGTCCAGCACATATGCAGCCATCATCAGACACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302675 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302675.1, NP_001289604.1 |
RefSeq Size | 3395 bp |
RefSeq ORF | 675 bp |
Locus ID | 52855 |
UniProt ID | Q8BG84 |
Cytogenetics | 7 2.31 cM |
Gene Summary | Functions as an inhibitory receptor that plays a constitutive negative regulatory role on cytolytic function of natural killer (NK) cells, B-cells and T-cells. Activation by Tyr phosphorylation results in recruitment and activation of the phosphatases PTPN6 and PTPN11. It also reduces the increase of intracellular calcium evoked by B-cell receptor ligation. May also play its inhibitory role independently of SH2-containing phosphatases. Modulates cytokine production in CD4+ T-cells, down-regulating IL2 and IFNG production while inducing secretion of transforming growth factor beta. Down-regulates also IgG and IgE production in B-cells as well as IL8, IL10 and TNF secretion. Inhibits proliferation and induces apoptosis in myeloid leukemia cell lines as well as prevents nuclear translocation of NF-kappa-B p65 subunit/RELA and phosphorylation of I-kappa-B alpha/CHUK in these cells. Inhibits the differentiation of peripheral blood precursors towards dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (e) lacks an in-frame exon in the coding region compared to variant a. The encoded isoform (e) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228606 | Lair1 (myc-DDK-tagged) - Mouse leukocyte-associated Ig-like receptor 1 (Lair1), transcript variant e |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review