Ywhaz (NM_001253807) Mouse Untagged Clone

CAT#: MC226391

Ywhaz (untagged) - Mouse tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz), transcript variant 4

USD 217.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ywhaz (NM_001253807) Mouse Untagged Clone
Symbol Ywhaz
Synonyms 1110013I11Rik; 14-3-3zeta; AI596267; AL022924; AU020854
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226391 representing NM_001253807
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCCTGCATGAAGTCTGTCACTGAGCAGGGAGCTGAGCTGTCGAATGAGGAGAGAAACCTTCTCT
CTGTTGCTTATAAAAACGTTGTAGGAGCCCGTAGGTCATCGTGGAGGGTCGTCTCAAGTATTGAGCAGAA
GACGGAAGGTGCTGAGAAAAAGCAGCAGATGGCTCGAGAATACAGAGAGAAGATCGAGACGGAGCTGCGT
GACATCTGCAACGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCGCAACCAGAAAGCA
AAGTCTTCTATTTGAAAATGAAGGGTGACTACTACCGTTACTTGGCCGAGGTTGCTGCTGGTGATGACAA
GAAAGGAATTGTGGACCAGTCACAGCAAGCATACCAAGAAGCATTTGAAATCAGCAAAAAGGAGATGCAG
CCGACACACCCCATCAGACTGGGTCTGGCCCTCAACTTCTCTGTGTTCTATTACGAGATCCTGAACTCCC
CAGAGAAAGCCTGCTCTCTTGCAAAAACAGCTTTCGATGAAGCCATTGCTGAACTTGATACATTAAGTGA
AGAGTCGTACAAAGACAGCACGCTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCGGAT
ACCCAAGGAGATGAAGCAGAAGCAGGAGAAGGAGGGGAAAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001253807
ORF Size 675 bp
Insert Size 675
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001253807.1, NP_001240736
RefSeq Size 3160
RefSeq ORF 675
Locus ID 22631
Cytogenetics 15|15 B3.1
Gene Summary Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.