Lgals8 (NM_001291057) Mouse Untagged Clone
CAT#: MC226389
Lgals8 (untagged) - Mouse lectin, galactose binding, soluble 8 (Lgals8), transcript variant 4
"NM_001291057" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Lgals8 |
Synonyms | 1200015E08Rik; AI326142; D13Ertd524e; Lgals-8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226389 representing NM_001291057
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCTTCAGAAAAGAAAAGTCCTTTGAGATCGTGTTCATGGTGCTCAAGAACAAATTCCAGGTGGCTG TGAACGGAAGGCATGTTCTGCTGTACGCCCACAGGATCAGCCCGGAGCAGATCGACACAGTGGGCATCTA CGGCAAAGTGAACATCCACTCCATCGGGTTCAGATTCAGCTCGGATTTACAGAGTATGGAAACATCTGCT CTGGGACTGACACAGATAAACAGAGAGAATATACAAAAGCCAGGCAAGCTCCAGCTGAGCCTGCCATTTG AAGCAAGGTTGAATGCCTCCATGGGTCCTGGACGAACCGTTGTCATTAAAGGGGAAGTGAACACCAATGC CCGAAGCTTTAATGTTGACCTAGTGGCAGGAAAAACAAGGGATATCGCTCTGCACTTGAACCCACGCCTC AATGTGAAAGCATTTGTAAGAAATTCCTTTCTTCAGGATGCCTGGGGAGAAGAGGAGAGAAATATTACCT GCTTCCCATTTAGTTCTGGGATGTACTTTGAGATGATAATCTACTGTGATGTCCGGGAATTCAAGGTTGC TATAAATGGTGTGCACAGCCTGGAGTACAAACACAGATTTAAAGACCTAAGCAGTATTGATACACTATCA GTCGATGGTGATATCCGTTTGCTGGATGTAAGGAGCTGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291057 |
Insert Size | 672 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291057.1, NP_001277986.1 |
RefSeq Size | 2718 bp |
RefSeq ORF | 672 bp |
Locus ID | 56048 |
Cytogenetics | 13 4.64 cM |
Gene Summary | Beta-galactoside-binding lectin that acts as a sensor of membrane damage caused by infection and restricts the proliferation of infecting pathogens by targeting them for autophagy. Detects membrane rupture by binding beta-galactoside ligands located on the lumenal side of the endosome membrane; these ligands becoming exposed to the cytoplasm following rupture. Restricts infection by initiating autophagy via interaction with CALCOCO2/NDP52. Required to restrict infection of bacterial invasion such as S.typhimurium. Also required to restrict infection of Picornaviridae viruses. Has a marked preference for 3'-O-sialylated and 3'-O-sulfated glycans.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, initiates translation at a downstream start codon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. Variants 4 and 5 encode the same isoform (3), which is shorter than isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228600 | Lgals8 (myc-DDK-tagged) - Mouse lectin, galactose binding, soluble 8 (Lgals8), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review