Plpp2 (NM_001302442) Mouse Untagged Clone

CAT#: MC226373

Ppap2c (untagged) - Mouse phosphatidic acid phosphatase type 2C (Ppap2c), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Plpp2
• Synonyms: L; Lpp2; PAP2-G; PAP2-gamma; PAP2c; Pp; Ppap2c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226373 representing NM_001302442
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGGGGTCATCATCACAGCTACTGTCATCCTTGTCTCATTGGGAGAAGCCTACCTGGTGTACACAG
  ACCGTCTTTATTCGCGATCCAACTTCAACAACTATGTAGCTGCCATCTACAAGGTGCTGGGAACCTTTCT
  GTTCGGGGCTGCTGTGAGCCAGTCTCTCACCGACCTGGCCAAGTACATGATTGGCCGTCTTCGACCCAGT
  TTCTTGGCTGTCTGTGACCCTGACTGGAGCCAGGTCAACTGTTCTGGCTATGTGCAGCTGGAGGTGTGCA
  GGGGCAGCCCTGCTAATGTCACGGAGGCCAGGCTGTCCTTCTACTCTGGCCACTCCTCCTTTGGCATGTA
  TTGCATGTTGTTCCTGGCGCTATATGTGCAGGCCCGGCTCTGCTGGAAGTGGGCACGGCTGCTGAGGCCC
  ACTGTTCAGTTCTTCTTGGTGGCCTTTGCAATCTATGTGGGCTATACCCGAGTGTCTGACCACAAGCACC
  ACTGGAGTGATGTCCTTGTCGGCCTCCTGCAGGGAGCCCTGGTGGCCTGCCTCACGGTCCGCTATGTTTC
  AGATTTCTTCAAATCCCGGCCACCCCAGCCCTGCCAGGAGGATGAAGTGCCGGAGCGCAAGCCCAGTCTG
  TCACTGACGCTGACCCTTGGTGACCGACCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302442
• Insert Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302442.1, NP_001289371.1
• RefSeq Size: 1604 bp
• RefSeq ORF: 663 bp
• Locus ID: 50784
• UniProt ID: Q9DAX2
• Cytogenetics: 10 39.72 cM
• Gene Summary: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1. Both variants 2 and 4 encode the same protein (isoform 2).