Nde1 (NM_001285504) Mouse Untagged Clone
CAT#: MC226325
Nde1 (untagged) - Mouse nuclear distribution gene E homolog 1 (A nidulans) (Nde1), transcript variant d
"NM_001285504" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nde1 |
Synonyms | 2810027M15Rik; AU042936; AW822251; mNudE; Nude |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226325 representing NM_001285504
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCTGGAAGACTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAATGCCTTCCTAGAGAGTGAGC TGGATGAGAAGGAGAATCTTCTAGAATCTGTGCAGAGGCTGAAGGATGAAGCCCGAGATCTGCGGCAGGA ATTGGCTGTGCAACAGAAGCAAGACAAGCCCCGGACACCCATGCCAGGCTCAGGGCAAGCCAAGAGGACA GACATGGCTGTGCAGGCCACAGGCTCTGTACCGTCTACTCCAGTAGCTCACCGAGGACCTAGCTCTGGTT TGAACACACCAGGAATGTTCAGACGTGGTCTGGACAGCTCCACTAGTGGGACGCCACTCACACCTGCAGC CCGGATATCAGCCCTAAACATCGTTGGGGACCTGCTTCGGAAAGTTGGGGCCCTGGAGTCCAAGCTAGCA TCATGCAGGAACTTCATGTATGATCAGTCCCCAAGCCGGACAAGTGGGCCAGCCTCAGGACGAGGAACCA AAAACAGAGATGGTGTTGACAGAAGGCCAGGCAGTACCAGTGTGGGCGATAAAGGGTCAGGAAAACGCTT GGAGTTTGGGAAGCCAGCCTCAGAGCCAGCATCACCAGCGCTACCATCCGCCCAGGGTGTGGTCAAGCTT TTGCTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001285504 |
Insert Size | 639 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001285504.1, NP_001272433.1 |
RefSeq Size | 2145 bp |
RefSeq ORF | 639 bp |
Locus ID | 67203 |
UniProt ID | Q9CZA6 |
Cytogenetics | 16 A1 |
Gene Summary | Required for centrosome duplication and formation and function of the mitotic spindle. Essential for the development of the cerebral cortex. May regulate the production of neurons by controlling the orientation of the mitotic spindle during division of cortical neuronal progenitors of the proliferative ventricular zone of the brain. Orientation of the division plane perpendicular to the layers of the cortex gives rise to two proliferative neuronal progenitors whereas parallel orientation of the division plane yields one proliferative neuronal progenitor and a post-mitotic neuron. A premature shift towards a neuronal fate within the progenitor population may result in an overall reduction in the final number of neurons and an increase in the number of neurons in the deeper layers of the cortex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (d) lacks an exon in the 5' end that results in the use of a downstream AUG, compared to variant a. The encoded isoform (d) has a shorter N-terminal and a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228536 | Nde1 (myc-DDK-tagged) - Mouse nuclear distribution gene E homolog 1 (A nidulans) (Nde1), transcript variant d |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review