Gdnf (NM_001301357) Mouse Untagged Clone

CAT#: MC226320

Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gdnf
• Synonyms: AI385739; ATF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226320 representing NM_001301357
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTCTGCCTTCCCGCTGCCCG
  CCGGTAAGAGGCTTCTCGAAGCGCCCGCTGAAGACCACTCCCTCGGCCACCGCCGCGTGCCCTTCGCGCT
  GACCAGTGACTCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCATGGATTTTATTCAAGCC
  ACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCGAAGAGAGAGGAATCGGC
  AGGCTGCAGCTGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAGAGGGGCAAAAATCGGGG
  GTGCGTTTTAACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATGAAACCAAGGAGGAACTG
  ATCTTTCGATATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAAAATACTAAAAAACCTGT
  CTCGGAGTAGAAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCGGTCGCCTTCGACGACGA
  CCTGTCGTTTTTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAACGGTGTGGATGT
  ATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301357
• Insert Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301357.1, NP_001288286.1
• RefSeq Size: 3449 bp
• RefSeq ORF: 636 bp
• Locus ID: 14573
• UniProt ID: P48540
• Cytogenetics: 15 A1
• Gene Summary: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.