Rnf185 (NM_001290472) Mouse Untagged Clone

CAT#: MC226188

Rnf185 (untagged) - Mouse ring finger protein 185 (Rnf185), transcript variant 2


  "NM_001290472" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rnf185"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rnf185
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226188 representing NM_001290472
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAAGTAAAGGGCCTTCGGCCTCTGCATCCACTGAGAATTCCAATGCAGGGGGGCCCAGTGGCAGCA
GCAATGGCACTGGTGAGAGTGGAGGGCAGGACAGCACCTTTGAGTGCAACATATGCCTGGACACAGCCAA
GGATGCTGTCATCAGCCTGTGTGGCCACCTCTTCTGTTGGCCGTGTTTACATCAGTGGTTGGAGACTAGG
CCTAACAGACAAGTGTGTCCAGTCTGCAAAGCTGGCATCAGCCGAGACAAAGTCATCCCCCTCTATGGCA
GAGGCAGCACTGGACAGCAGGATCCCAGAGAGAAGACTCCTCCTCGTCCTCAAGGCCAGAGGCCAGAGCC
AGAAAATAGAGGGGGATTTCAAGGATTTGGATTTGGAGATGGTGGCTTTCAGATGTCTTTTGGAATTGGA
GCATTTCCATTTGGGATATTTGCCACAGCATTTAACATAAATGATGGACGGCCTCCTCCAGCTGTCCCTG
GGACACCCCAGTATGTGGATGAGCAGTTCCTGTCACGCCTCTTCCTGTTTGTCGCCCTGGTGATCATGTT
CTGGCTCCTGATCGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290472
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290472.1, NP_001277401.1
RefSeq Size 3389 bp
RefSeq ORF 579 bp
Locus ID 193670
UniProt ID Q91YT2
Cytogenetics 11 A1
Gene Summary E3 ubiquitin-protein ligase that regulates selective mitochondrial autophagy by mediating 'Lys-63'-linked polyubiquitination of BNIP1. Acts in the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway, which targets misfolded proteins that accumulate in the endoplasmic reticulum (ER) for ubiquitination and subsequent proteasome-mediated degradation. Protects cells from ER stress-induced apoptosis. Responsible for the cotranslational ubiquitination and degradation of CFTR in the ERAD pathway. Preferentially associates with the E2 enzymes UBE2J1 and UBE2J2 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks part of the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.