Meaf6 (NM_001290701) Mouse Untagged Clone
CAT#: MC226187
Meaf6 (untagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), transcript variant 2
"NM_001290701" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Meaf6 |
Synonyms | 2310005N01Rik; 2810036M01Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226187 representing NM_001290701
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGATGCACAACAAGACGGCGCCGCCGCAGATCCCAGACACCCGGCGGGAGCTGGCCGAGCTGGTTA AGCGGAAGCAGGAGCTGGCGGAAACACTTGCAAACTTGGAGAGACAGATATATGCTTTTGAAGGAAGCTA CCTGGAAGACACTCAGATGTATGGCAATATTATCCGTGGCTGGGATCGGTATTTGACCAATCAAAAGAAC TCCAATAGCAAAAACGACCGGAGGAACCGGAAGTTCAAGGAGGCCGAACGGCTCTTCAGCAAATCCTCAG TCACGTCGGCTGCTGCAGTAAGTGCCTTGGCAGGGGTTCAGGACCAGCTCATCGAAAAGAGGGAACCAGG AAGTGGGACGGAAAGCGATACTTCTCCAGACTTCCACAATCAGGAAAACGAGCCTGCGCAGGAGGACCCC GAGGACCTAGACGGCTCCGTCCAGGGAGTGAAACCTCAGAAAGCCGCCTCTTCCACCTCCTCAGGAAGCC ACCACAGCAGCCACAAAAAACGGAAGAATAAAAACCGGCACAGGATTGATCTGAAGTTAAACAAAAAGCC CCGAGCTGACTATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290701 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290701.1, NP_001277630.1 |
RefSeq Size | 1382 bp |
RefSeq ORF | 576 bp |
Locus ID | 70088 |
UniProt ID | Q2VPQ9 |
Cytogenetics | 4 D2.2 |
Gene Summary | Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate exon in 3' coding region and uses an alternate splice site in the 3' terminal exon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228398 | Meaf6 (myc-DDK-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review