G6pc2 (NM_001289857) Mouse Untagged Clone

CAT#: MC225958

G6pc2 (untagged) - Mouse glucose-6-phosphatase, catalytic, 2 (G6pc2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: G6pc2
• Synonyms: G6pc; G6pc-rs; I; IGRP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225958 representing NM_001289857
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATTTCCTTCATAGGAGTGGAGTGCTTATTATTCATCATCTGCAGGAGGACTACCGGACTTACTATG
  GTTTTCTAAATTTTATGTCCAATGTTGGAGACCCCCGAAATATCTTTTCTATTTACTTCCCACTTTGGTT
  TCAGTTGAATCAGAATGTTGGAACCAAGATGATCTGGGTAGCGGTCATAGGGGACTGGTTCAATCTCATA
  TTTAAATGGATATTGTTTGGCCATCGTCCTTACTGGTGGATACAAGAAACTGAGATTTATCCAAATCATT
  CAAGCCCATGTCTTGAGCAGTTTCCTACTACGTGTGAAACAGGCCCAGGAAGTCCATCTGGCCACGCAAT
  GGGCTCATCGTGCGTCTGGTATGTCATGGTAACAGCTGCCCTAAGCTACACCATCAGCCGGATGGAGGAG
  TCCTCTGTCACTCTGCACAGGGATGCTAGTAGCCGAGGCCTTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289857
• Insert Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289857.1, NP_001276786.1
• RefSeq Size: 1950 bp
• RefSeq ORF: 465 bp
• Locus ID: 14378
• UniProt ID: Q9Z186
• Cytogenetics: 2 39.66 cM
• Gene Summary: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (3) differs in the 3' UTR and lacks an alternate exon in the coding region resulting in a frameshift and an early stop codon compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.