Csn1s2b (NM_001301334) Mouse Untagged Clone
CAT#: MC225854
Csn1s2b (untagged) - Mouse casein alpha s2-like B (Csn1s2b), transcript variant 2
"NM_001301334" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Csn1s2b |
Synonyms | AW987150; Cs; Csnd; Csne |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225854 representing NM_001301334
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTTCATCATTCTTACTTGCCTTTTGGCCGTTGCTCTTGCAAAGCAGAGGATGGAGCAATACATCT CCAGTGAGGAGTCCATGGATAACTCTCAAGAAAACTTTAAGCAGAATATGGATGTGGCCTTTTTTCCCAG TCAGGAAACTGTAGAGAACATTTACATTCCCCAAATGGAATCTGTTGAAGCTCCCATGAAGGTATCTGAC ATCATTTCTCAGCAACAATACAACCAGAAAATGATGGACATGAGTAAAACTGTGATGACTGAAGAAAGTA AGAACATCCAAGACTACATGAACAAAATGAAACGATACAGCAAGATCACCTGGCCACAGTTTGTAAAGCT TCTCCATCAATACCAGAAAACCATGACCCCGTGGAGCTATTACCCATCTACCCCCAGCCAGGTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301334 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301334.1, NP_001288263.1 |
RefSeq Size | 751 bp |
RefSeq ORF | 417 bp |
Locus ID | 12992 |
UniProt ID | P02664 |
Cytogenetics | 5 43.56 cM |
Gene Summary | This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228065 | Csn1s2b (myc-DDK-tagged) - Mouse casein alpha s2-like B (Csn1s2b), transcript variant 2 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review