Csn1s2b (NM_001301334) Mouse Untagged Clone

CAT#: MC225854

Csn1s2b (untagged) - Mouse casein alpha s2-like B (Csn1s2b), transcript variant 2

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Csn1s2b (NM_001301334) Mouse Untagged Clone
Symbol Csn1s2b
Synonyms AW987150; Csnd; Csne
Vector pCMV6-Entry
Sequence Data
>MC225854 representing NM_001301334
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTTCATCATTCTTACTTGCCTTTTGGCCGTTGCTCTTGCAAAGCAGAGGATGGAGCAATACATCT
CCAGTGAGGAGTCCATGGATAACTCTCAAGAAAACTTTAAGCAGAATATGGATGTGGCCTTTTTTCCCAG
TCAGGAAACTGTAGAGAACATTTACATTCCCCAAATGGAATCTGTTGAAGCTCCCATGAAGGTATCTGAC
ATCATTTCTCAGCAACAATACAACCAGAAAATGATGGACATGAGTAAAACTGTGATGACTGAAGAAAGTA
AGAACATCCAAGACTACATGAACAAAATGAAACGATACAGCAAGATCACCTGGCCACAGTTTGTAAAGCT
TCTCCATCAATACCAGAAAACCATGACCCCGTGGAGCTATTACCCATCTACCCCCAGCCAGGTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001301334
ORF Size 417 bp
Insert Size 417
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001301334.1, NP_001288263
RefSeq Size 751
RefSeq ORF 417
Locus ID 12992
Cytogenetics 5 E1|5 43.56 cM
Gene Summary This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.