Timp1 (NM_001294280) Mouse Untagged Clone
CAT#: MC225847
Timp1 (untagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 3
"NM_001294280" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Timp1 |
Synonyms | Clgi; EPA; Timp; TIMP-1; TPA-S1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225847 representing NM_001294280
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTAAAAGGATTCAAGGCTGTGGGAAATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAA GCCTCTGTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAA CGGAAATTTGCACATCAGTGCCTGCAGCTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGA GCTTTCTCAAAGACCTATAGTGCTGGCTGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCA AACTGGAGAGTGACACTCACTGTTTGTGGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCG TCACTTTGCTTGCCTGCCACGGAATCCAGGCTTGTGCACCTGGAGATCCCTTGGGGCCCGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001294280 |
Insert Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001294280.2, NP_001281209.1 |
RefSeq Size | 825 bp |
RefSeq ORF | 414 bp |
Locus ID | 21857 |
Cytogenetics | X 16.38 cM |
Gene Summary | Metalloproteinase inhibitor that functions by forming one to one complexes with target metalloproteinases, such as collagenases, and irreversibly inactivates them by binding to their catalytic zinc cofactor. Acts on MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, MMP10, MMP11, MMP12, MMP13 and MMP16. Does not act on MMP14 (By similarity). Also functions as a growth factor that regulates cell differentiation, migration and cell death and activates cellular signaling cascades via CD63 and ITGB1. Plays a role in integrin signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate exon resulting in the use of a downstream start codon compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228058 | Timp1 (myc-DDK-tagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 3 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review