Nppb (NM_001287348) Mouse Untagged Clone
CAT#: MC225738
Nppb (untagged) - Mouse natriuretic peptide type B (Nppb), transcript variant 2
"NM_001287348" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nppb |
Synonyms | AA408272; BNF; BNP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225738 representing NM_001287348
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATCTCCTGAAGGTGCTGTCCCAGATGATTCTGTTTCTGCTTTTCCTTTATCTGTCACCGCTGGGAG GTCACTCCTATCCTCTGGGAAGTCCTAGCCAGTCTCCAGAGCAATTCAAGATGCAGCTGCTGGAGCTGAT AAGAGAAAAGTCGGAGGAAATGGCCCAGAGACAGCTCTTGAAGGACCAAGGCCTCACAAAAGAACACCCA AAAAGAGTCCTTCGGTCTCAAGGCAGCACCCTCCGGGTCCAGCAGAGACCTCAAAATTCCAAGGTGACAC ATATCTCAAGCTGCTTTGGGCACAAGATAGACCGGATCGGATCCGTCAGTCGTTTGGGCTGTAACGCACT GAAGTTGTTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287348 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287348.1, NP_001274277.1 |
RefSeq Size | 778 bp |
RefSeq ORF | 363 bp |
Locus ID | 18158 |
UniProt ID | P40753 |
Cytogenetics | 4 78.57 cM |
Gene Summary | This gene encodes a secreted protein that belongs to the family of natriuretic peptides. Its precursor protein is processed to generate the active mature peptide. The mature peptide is a cardiac hormone that plays a role in ventricular remodeling as well as blood pressure regulation. Mice lacking this gene exhibit cardiac fibrosis. In humans this gene is associated with congestive heart failure, low bone-mineral density and postmenopausal osteoporosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform 2, also known as Short isoform) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227949 | Nppb (myc-DDK-tagged) - Mouse natriuretic peptide type B (Nppb), transcript variant 2 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review