Nppb (NM_001287348) Mouse Untagged Clone

CAT#: MC225738

Nppb (untagged) - Mouse natriuretic peptide type B (Nppb), transcript variant 2


  "NM_001287348" in other vectors (1)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nppb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nppb
Synonyms AA408272; BNF; BNP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225738 representing NM_001287348
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCTCCTGAAGGTGCTGTCCCAGATGATTCTGTTTCTGCTTTTCCTTTATCTGTCACCGCTGGGAG
GTCACTCCTATCCTCTGGGAAGTCCTAGCCAGTCTCCAGAGCAATTCAAGATGCAGCTGCTGGAGCTGAT
AAGAGAAAAGTCGGAGGAAATGGCCCAGAGACAGCTCTTGAAGGACCAAGGCCTCACAAAAGAACACCCA
AAAAGAGTCCTTCGGTCTCAAGGCAGCACCCTCCGGGTCCAGCAGAGACCTCAAAATTCCAAGGTGACAC
ATATCTCAAGCTGCTTTGGGCACAAGATAGACCGGATCGGATCCGTCAGTCGTTTGGGCTGTAACGCACT
GAAGTTGTTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287348
Insert Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287348.1, NP_001274277.1
RefSeq Size 778 bp
RefSeq ORF 363 bp
Locus ID 18158
UniProt ID P40753
Cytogenetics 4 78.57 cM
Gene Summary This gene encodes a secreted protein that belongs to the family of natriuretic peptides. Its precursor protein is processed to generate the active mature peptide. The mature peptide is a cardiac hormone that plays a role in ventricular remodeling as well as blood pressure regulation. Mice lacking this gene exhibit cardiac fibrosis. In humans this gene is associated with congestive heart failure, low bone-mineral density and postmenopausal osteoporosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform 2, also known as Short isoform) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.