Atp5g3 (NM_001301722) Mouse Untagged Clone
CAT#: MC225601
Atp5g3 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), transcript variant 3
"NM_001301722" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Atp5g3 |
Synonyms | 6030447M23; Atp5mc3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225601 representing NM_001301722
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCGCCTGCGCCAAGCTCGCCCGCACCCCCGCTCTGATCCGAGCTGGATCCAGAGTTGCATATAGAC CAATTTCTGCATCAGTGTTATCTCGGCCAGAGACTAGGACTGGAGAGGGCTCTACAGTTTTTAATGGGGC CCAGAATGGTGTGTGTCAGCTGATCCGAAGGGAGTTTCAGACCAGTGTAATCAGCAGAGACATTGATACT GCTGCCAAATTCATTGGTGCAGGTGCTGCAACAGTAGGAGTTGCTGGTTCTGGTGCTGAAACCCTTCACT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301722 |
Insert Size | 282 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301722.1, NP_001288651.1 |
RefSeq Size | 686 bp |
RefSeq ORF | 282 bp |
Locus ID | 228033 |
Cytogenetics | 2 C3 |
Gene Summary | The protein encoded by this gene is a subunit of mitochondrial membrane ATP synthase, the enzyme that catalyzes ATP synthesis during oxidative phosphorylation. This gene encodes subunit 9, which is present in multiple copies in the transmembrane part of the ATP synthase complex. Phenotype and gene expression profiles suggest correlations between this gene and alcoholism- and obesity-related phenotypes. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform b, which has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227812 | Atp5g3 (myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), transcript variant 3 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review