Pkig (NM_001039390) Mouse Untagged Clone
CAT#: MC225520
Pkig (untagged) - Mouse protein kinase inhibitor, gamma (Pkig), transcript variant 2
"NM_001039390" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "Pkig"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pkig |
Synonyms | PKIgamma |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225520 representing NM_001039390
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGAAGTCGAGTCCTCCTACTCGGACTTCATCTCCTGCGACCGGACAGGCCGTCGGAATGCAGTCC CTGACATCCAGGGTGACTCGGAGGCCGTGAGTGTGCGGAAGCTCGCTGGAGACATGGGCGAGCTCGCACT TGAGGGAGCAGAAGGACAGGCAGAGGGAAGTACCCCCGACAAGGAAGCCAGCAGCCAGCCTGAGAGCAGT GATGCGAACACCTCATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039390 |
Insert Size | 231 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039390.2, NP_001034479.1 |
RefSeq Size | 1139 bp |
RefSeq ORF | 231 bp |
Locus ID | 18769 |
UniProt ID | O70139 |
Cytogenetics | 2 84.4 cM |
Gene Summary | Extremely potent competitive inhibitor of cAMP-dependent protein kinase activity, this protein interacts with the catalytic subunit of the enzyme after the cAMP-induced dissociation of its regulatory chains.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 4. Variants 1, 2, 3, 4, and 5 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.