Cox6b2 (NM_001289850) Mouse Untagged Clone
CAT#: MC225487
Cox6b2 (untagged) - Mouse cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), transcript variant 5
"NM_001289850" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cox6b2 |
Synonyms | 1700067P11Rik; BC048670; COXVIB2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225487 representing NM_001289850
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGGGTGTTCAAGCCCAGAAGCCCCCTCCGGGCCAATGGACAACGCCGCCCTTTGATCCGCGCTTCC CTAACCAGAACCAGACGCGTAACTGCTACCAGAATTTTCTGGACTACCACCGGTGTGTGAAGACCATGAA TCGCCGCGGAAAGAGCACACAACCCTGTGCAGCGCTGGAATGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001289850 |
Insert Size | 183 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289850.1, NP_001276779.1 |
RefSeq Size | 521 bp |
RefSeq ORF | 183 bp |
Locus ID | 333182 |
UniProt ID | Q80ZN9 |
Cytogenetics | 7 A1 |
Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. This protein may be one of the heme-binding subunits of the oxidase (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, resulting in a frameshift and an early stop codon, compared to variant 3. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227698 | Cox6b2 (myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), transcript variant 5 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review