Rnf216 (NM_207110) Mouse Untagged Clone

CAT#: MC222544

Rnf216 (untagged) - Mouse ring finger protein 216 (Rnf216), transcript variant B, (10ug)

USD 1,154.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rnf216 (NM_207110) Mouse Untagged Clone
Symbol Rnf216
Synonyms 2810055G22Rik; AI647468; AU019462; C86502; F830018F18Rik; TRIAD3; Ubce7ip1; UIP83
Vector pCMV6-Entry
Sequence Data
>MC222544 representing NM_207110
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAGGGAAACAACAAAGAGGAGGTCATTCACTTGAACAACTTTCCCTGCCACCGGGGAAAGGAAT
GGATGGCTGTCAGAGAGGGGCCCATCACCATATCTGACTCCTCTGATGAGGAAGGGATTCCAATGCTGGT
TACCCCAGCTACAGAGCAACAGGAAGACGACCTGGATGATGATGTCATCCTGACAGAAACACATAAACCT
CAGACATCCCGGCCCAATCTCATCAAACCAGCTGCCCAGTGGCAAGATCTGAACAGATTGGGAGAAGAAA
GGCCTAGAAAATCTAGAGCAGACTTTGAAGCAGATATCCACAACTATTTTTCCTTTTGTAACAACTCATT
GTTTGGTTCTGGGGCACAGGATGATTCTGAGGATGAATATGGTGGATTTCTGGATCTTGAGAGTGGCAAA
AAAGAGGGAGAAGCCAAACCTGGACCAAGCAGTAAGCAGACAGCAGACGATATTGTCAACCCCAGATTGG
AGCAGAAAGTCATTATATTGGGAGAAAATGGTCTTCTTTTCCCAGAAAGTGAGCCTTTGGAAGTTCAGAA
CCAATCATCCGAAGACTCAGAGACAGAGCTCTTATCAAATCCTGGAGAGCCAGCTGCCTCAGTAGATGAC
CAGCTAATTGGAGAAGAGTACTGGCTTGACCATCCATACTTCCAGGCTCCGAATCCACAGCCTCAGGAAA
GAACAAACCAGGTTGTGCCCCAAGAGCGACATTCTGAATCAGAAATGGGCCCAATGTTTTTCCGCCATGA
TTTCCCAGAGCCAGCTTTTCCAAGGCCAGAACCCCAGCAGGAGGGGATTCCAGGCCCTGCTTCTCCACAG
CCAGCCCATCCTCTAGGAGAGCTTGAAGACCAGCAGTTAGCAATTGATGAAGACCCTGGGCCAGCCTTCC
CCCTGTCAGGACCTCAGGAGGCCAACTTGGCAAACATGTGGGAACAAGAAGCTGCTGAGGTAGATCAAGA
CCTCATTCCACTGTTAGTGAAAGAAACGGAAGCAAGATTTCCAGATGTAGCAAGTGGATATGTTGAAGAA
ATAATTCATTTGAAAAATTACTATGATTTGAATGTACTTTGTAATTTTCTTCTGGAAAACCCAGATTATC
CAAAGAGAGAAGACCGGCTTATTATCCACCCCAGCAGCAGCCTGCTTGCCAGCCAGGATGACGCGAAGTT
GCCTAAAATAGACTTTTTTGACTATTCCAAATTGACTCCACTTGACCAGCGCTGCTTCATCCAAGCTGCT
GACCTCCTGATGGCTGATTTCAAGATGCTTAGCAGCCAGGACATCAAGTGGGCCCTTCATGAGCTCAAAG
GACACTATGCAATCACCCGAAAGGCCTTTTCCGATGCCATTAAGAAATGGCAGGAGTTGTCACCTGAAAC
CAGTGGAAAACGGAAAAAGAGGAAAGAAATGAATCAGTATTCTTTCATAGATTTCAAGTTTGAACAAGGA
AACATAAAAATAGAAAAGAGGATGTTCTTTCTGGAAAACAAGCGTCGACACTGTAGGTACTATGACCATC
AGGCCCTCCTTCCAGCTGTGAAACAGGAGCAGGAATTCTATGAGCAGAAAATTAAAGAGATGGCAGAGCA
TGAAGACTTCTTGCTCGCCCTGCAGATGAATGAAGAACAGTATCAAAAGGATGGCCAGCTGATTGAATGC
CGCTGTTGCTATGGGGAGTTTCCATTTGAGGAGCTGACACAATGCGCCGATGCTCACTTGTTCTGCAAAG
AATGTCTCATCAGATATGCCCAGGAGGCAGTGTTTGGATCTGGAAAGTCAGAACTCAGCTGCATGGAAGG
CAGCTGCACGTGCTCCTTCCCAACCAGTGAGCTGGAGAAGGTGCTCCCCCAGACCATTCTGTACAAATAC
TATGAACGGAAAGCTGAGGAAGAAGTCGCTGCAGCCTATGCTGATGAGCTTGTCCGGTGCCCCTCCTGCA
GCTTCCCTGCTCTGTTGGACAGCGATGTGAAGAGGTTCAGCTGCCCCAACCCACGCTGCCGAAAGGAGAC
CTGTAGGAAGTGTCAGGGACTCTGGAAAGAACACAACGGCCTCACCTGTGAAGAGCTGGCAGAAAAGGAT
GACATCAAGTACCGGACATCCATTGAAGAAAAAATGACTGCTGCTCGGATTAGAAAATGTCACAAGTGTG
GAACTGGCCTCATCAAGTCTGAAGGCTGCAACCGCATGTCTTGCCGCTGTGGTGCCCAGATGTGCTACCT
CTGTCGAGTTTCTATCAATGGCTATGACCATTTCTGCCAGCATCCTCGCTCTCCAGGAGCCCCTTGCCAA
GAATGTTCCAGGTGCTCCCTGTGGACCGACCCCACTGAAGATGATGAAAAGCTGATTGAGGAAATCCAAA
AGGAGGCCGAGGAGGAACAGAAGAGAAAGAATGGAGAGAACACCTTCAAACGCATCGGGCCCCCACTGGA
GAAGCCAGCTGAGAAGGTGCAGCGTGTGGAAGCCCTGCCGCGGCCTGTCCCACAGAACCTGCATCCTCAG
ATGCCGCCCTATGCCTTTGTTCACCCACCCTTCCCCCTGCCACCTGTGCGGCCCGTGTTCAACAACTTCC
CCATCAACATGGGTCCTGTGCCCGCTCCCTATGTCCCCCCTCTGCCCAACGTGCGTGTCAACTATGACTT
TGGCCACATGCACGTGCCCCTGGAGCACAACCTGCCCATGCACTTTGGCCCCCAACCACGGCATCGCTTC
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_207110
ORF Size 2733 bp
Insert Size 2733
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_207110.1, NP_996993
RefSeq Size 4692
RefSeq ORF 2733
Locus ID 108086
Cytogenetics 5|5 G2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.