Vmn2r47 (NM_001105151) Mouse Untagged Clone

CAT#: MC222133

Vmn2r47 (untagged) - Mouse vomeronasal 2, receptor 47 (Vmn2r47), (10ug)

USD 1,082


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vmn2r47 (NM_001105151) Mouse Untagged Clone
Symbol Vmn2r47
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC222133 representing NM_001105151
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCATTTTCATGGGAGTCTTCTTCCTCCTTAATATTACACTTCTCATGGCCAATTTCATTGATCCCA
GGTGCTTTTGGAGAATAAATTTGGATGAAATAACGGATGAATATTTGGGATTATCTTGTACTTTCATCCT
GGCAGCAGTTCAGACACCCACTGAAAAAGATTATTTCAACAAGACTCTTAATGTTCTAAAAACAACTAAA
AACCACAAATATGCTTTGGCATTGGTGTTTGCAATGGATGAAATCAACAGAAATCCTGATCTTTTACCAA
ATATGTCTTTGATTATAAGATACACTTTGGGCCTTTGTGATGGAAAAACTGTAACACCTACACCATATTT
ATTTCATAAAAAAAAACAAAGCCCTATTCCTAATTATTTCTGTAATGAAGAGACTATGTGTTCATTTCAG
CTTTCAGGACCCAAGTGGGATGTATCTTTAAGTTTCTGGATGTACCTGGACAGCTTCTTATCTCTGCGTA
TCCTTCAGCTTACCTATGGACCTTTCTATTCTATCTTCAGTGATGATGAACAATATCCCTATCTCTATCA
GATGGCCCCAAAGGACACATCTCTAGCATTGGCAATGGTCTCCTTCATACTTTATTTGAAATGGAACTGG
ATTGGCCTTGTCATCCCAGATGACGATCAAGGAAACCAATTTCTTTTAGAGTTGAAGAAACAGAGTGAAA
ACAAGGAAATTTGCTTTGCCTTTGTGAAAATGATCTCTGTTGATGATACTTCATTTCCACATAAAACTGA
AATGGACTACAACCAAATTGTGATGTCATCCACAAATGTTATTATCATTTATGGAGAAACACGCAATTTC
ATTTATTTGATCTTCAGAATGTGGGAACCTCCCATTTTACAGAGAATATGGATCACCACAAAACAATTGA
ATTTCCCTACCAGGAAGACAGACATAAGTCATGGCACATTCTATGGATCACTTACTTTTCTACCCCACCA
TGGTGAGATTTCTGGCTTTAAAAAGTTTGTACAGACATGGTTCCATGTCAGAAACACAGATTTATATTTA
GTAATGCCAGAGTGGAACTATTTTAACTATGTAAGCTCAGCATCCAATTGTAAAATACTGAAGAACAATT
CATCTGATGCCTCATTTGATTGGCTAATGGAACAGAAGTTTGACATGACCTTTAGTGAGAATAGTCATAA
CATATACAATGCTGTGCATGCCATAGCCCATGCCCTCCATGAGATGAATCTGCAACAGGCTGATAATCAG
GCAATAGGCAATGGAAAAGGAGCCAGTTCTCACTGCTTGAAGGTAAACTCCTTTCTAAGAAGGACCTGCT
TCACTAATCCTCTTGGGGACAAAGTGTTTATGAAGCAAAGAGTAATAATGCAGGATGAATATGATATTAT
TCACTTTGGGAATCTCTCACAACACCTTGGGATTAAGATGAAGTTAGGAAAGTTCAGCCCATATTTACCA
CATGGTCGACACTCTCACTTATATGTAGACATGATTGAGTTGGCCACAGGAAGAAGAAAGATGCCATCCT
CTGTGTGCAGTGCAGATTGTAGTCCTGGATTCAGAAGATTATGGAAGGAGGGAATGGCAGCCTGCTGTTT
TGTTTGCAGCCCCTGCCCTGAAAATGAAATTTCTAATGAGACAAATATGGATCAATGTGTGAATTGTCCA
GAATACCAATATGCCAACACAGAACAGAACAAATGTATTCAGAAAGGTGTCACCTTCCTAAGCTATGAAG
ACCCCTTGGGGATGGCACTTGCCTTAATGGCCTTCTGCTTCTCTGCATTCACAGCTGTGGTACTTTGTGT
CTTTGTGAAGCACCATGACACTCCTATTGTGAAGGCCAATAACAGAAGCCTCAGCTACCTATTACTCATG
TCACTCATGTTCTGTTTTCTGTGCTCCTTTTTCTTCATTGGCCTTCCAAACAGAGCCATCTGTGTCTTAC
AGCAAATCACATTTGGAATTGTATTCACTGTGGCTGTTTCCACAGTTCTGGCCAAAACAGTCACTGTGGT
TCTGGCTTTCAAAGTCACAGACCCAGGGAGAAGATTGAGGAACTTCCTTGTATCAGGGACACCCAACTAC
ATTATTCCTATATGTTCCCTACTCCAATGTGTTCTGTGTGCAATCTGGCTAGCAGTTTCTCCTCCCTTTG
TTGATATTGATGAACACACTCTCCATGGCCACATCATCATTGTGTGCAACAAGGGCTCAGATACTGCATT
CTACTGTATCCTGGGATATTTGGCCTGCATGGCACTTGGAAGCTTCTCTCTGGCTTTCTTGGCCAAGAAT
CTGCCTGACACATTCAATGAAGCCAAGTTCTTGACCTTCAGCATGCTAGTGTTCTGCAGTGTCTGGGTCA
CCTTCCTCCCTGTCTACCATAGCACCAAGGGCAAACACATGGTTGCTGTGGAGATCTTCTCCATCTTGGC
ATCCAGTGCAGGGATCCTTGGATGTATTTTTGTACCCAAGATTTATATCATTTTTATGCGACCAGAGAGA
AATTCTACCCAAAAGATCAGGGAAAAATCATATTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001105151
ORF Size 2559 bp
Insert Size 2559
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001105151.1, NP_001098621
RefSeq Size 2559
RefSeq ORF 2559
Locus ID 100042891
Cytogenetics 7|7 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.