Sorbs3 (NM_011366) Mouse Untagged Clone

CAT#: MC221161

Sorbs3 (untagged) - Mouse sorbin and SH3 domain containing 3 (Sorbs3), (10ug)

USD 938.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sorbs3 (NM_011366) Mouse Untagged Clone
Symbol Sorbs3
Synonyms SCAM-1; Sh3d4; SH3P3; vinexin-g
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC221161 representing NM_011366
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGGATTCTTGGAGTGGGAAGATCTTCAGCTTCGTCTTTGAACAACAAAGAAGACAATGAAAGTG
ATGTAGCCCTTCTTAGTCCCAAGGACCCTAACAGAGTACACACGAAGGAGCAGCTGGCACATCCTGCGTC
CTCCAACCTTGACCCAAGCATGCAAGGCCTCCCTGCTGGGCTCAGCCTGGATGATTTCATCCCTGGTCAC
CTCCGAACCCATATAGGCTCATCCTCCCGGGGGACAAGGGTGCCAGTGATCCGGAATGGTGGCTCCAACA
CCCTTAATTTCCAGTTTCATGACCCTGCGCCCAGGACTGTGTGCAATGGCTGCCCCCCACCCAGGAGAGA
TGGTTCCTTGAATCCAGACCCAGCATGGTATCAGACCTGGCCAGGCCCTGGGAGCCGGCCCTCTATGAGC
CCGAAGCCACCTGCTTCCCAGCATGCCCAGAACTGGTCAGCCACATGGACCAAGGACAGCAAGCGACAGG
ACAAGCGCTGGGTGAAGTACGAGGGAATCGGGCCCGTGGATGAGAGCGGCATGCCCATTGCCCCCCGATC
TAGTGTTGACAGCCCCAGAGACTGGTATCGAAGAATGTTCCAGCAAATTCACCGGAAAATGCCAGACCTG
CAGCTGGACTGGACCTTGGAAGACCCACCCAAAGTGGTTTCCGCACGCGCCTCTTCTGCAGAACCCAGGC
ATCTAGGGACCCTGCAAAGACCTGCCTCCAGGCCTGGCACAACTGAGACTTCTAGCGGAAGAAACTGGAA
CCACTCTGAAGAGACATCTAGAAACACCTTTAACTATAATTTTAGACCATCCTCTTCAGGGCTTCATCCC
CCAAATCAGGTGCCTAGACATCGAGAGAAAGTAGAGAATGTCTGGACAGAAGATTCCTGGAACCAGTTTC
TGCACGAACTAGAAACTGGGCATAAGCCTAAGAAACCACTGGTGGATGACCCTGTTGAGAAGCCTGCACA
GCCCATTGAGGTCCTGCTAGAGAGAGAACTGGCCAAGCTGAGCGCAGAGCTGGACAAGGACCTGCGGGCC
ATTGAGACCCGCCTGCCGTCCCCCAAGAACTCTCAGGCTCCACGACGGCCCCTTGAGCAGCCCGGCTTGG
AGCAGCAGCCCTCAGCCCGTCTGTCCTCAGCCTGGAGGCCCAACTCACCGCATGCACCTTACTTCAGTTC
CTCCCGACCCCTGAGCCCCCACAGAATGGCAGATGGAGGAGGAAGCCCCTTTCTGGGACGTAGAGATTTT
GTCTACCCTTCCTCAGCCCGAGAGCCTAGCGCCTCTGAAAGGGGTAGCAGCCCTTCGAGGAAAGAAGAGA
AGAAGAGGAAGGCCGCCCGGCTCAAGTTTGACTTCCAGGCACAGTCCCCCAAGGAGCTGTCTCTGCAGAA
GGGTGACATTGTCTATATCCATAAGGAAGTGGACAAGAACTGGCTGGAGGGGGAACACCATGGCCGGCTG
GGCATCTTCCCAGCTAATTATGTGGAGGTTCTGCCTGCCGATGAGATTCCCAAGCCCATCAAGCCGCCCA
CATACCAGGTGCTGGAGTATGGCGATGCAGTAGCCCAGTATACCTTCAAGGGAGACCTGGAGGTAGAACT
GTCCTTCCGAAAGGGAGAACGCATCTGCCTGATCCGCAAGGTGAACGAACATTGGTATGAGGGGCGCATC
ACTGGCACTGGACGCCAGGGCATCTTCCCTGCCAGCTACGTGCAGATAAACCGAGAGCCCCGGCTCAGGC
TTTGTGATGATGGTCCCCAGCTCCCTGCATCACCTAACCCGACAACCACTGCTCACCTAAGCAGCCACTC
CCACCCCTCCTCAATACCTGTGGACCCCACTGACTGGGGAGGTCGAACCTCCCCTCGACGCTCCGCCTTT
CCCTTCCCCATCACCCTCCAGGAGCCCAGATCCCAAACCCAGAGTCTCAATACCCCTGGACCAACCCTGT
CCCATCCTCGAGCCACCAGCCGTCCCATAAACCTGGGACCCTCCTCCCCAAACACAGAGATACACTGGAC
TCCGTACCGGGCCATGTACCAGTACAGGCCCCAGAATGAGGACGAGCTGGAACTTCGAGAGGGGGACCGT
GTGGATGTCATGCAGCAATGTGACGATGGCTGGTTTGTGGGTGTCTCCCGGCGAACTCAGAAATTTGGGA
CATTCCCTGGAAATTATGTAGCCCCAGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_011366
ORF Size 2202 bp
Insert Size 2202
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_011366.3, NP_035496
RefSeq Size 2948
RefSeq ORF 2202
Locus ID 20410
Cytogenetics 14 D2|14 36.27 cM
Gene Summary Promotes up-regulation of actin stress fiber formation. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.